Total RNA was extracted using TRIzol reagent (Life Technologies, Tokyo, Japan), and contaminated genomic DNA was removed by treatment with DNAse I (TaKaRa Bio, Inc., Otsu, Japan). Real-time RT-PCR was performed using a One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (TaKaRa Bio) in a QuantStudio3 Real-Time PCR System (Applied Biosystems, MA, USA). The following primer sequences were used: RuV, sense, 5′-CCA CTG AGA CCG GCT GCG A-3′; antisense, 5′-GCC TCG GGG AGG AAG ATG AC-3′; and PPIA, sense, 5′-ATG CTG GAC CCA ACA CAA AT-3′ and antisense, 5′-TCT TTC ACT TTG CCA AAC ACC-3′.
One step tb green primescript plus rt pcr kit perfect real time
Manufactured by Takara Bio
Sourced in United States
The One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) is a product designed for reverse transcription and real-time PCR amplification of RNA targets. It utilizes the TB Green dye for detection of amplified products.
Automatically generated - may contain errors
Lab products found in correlation
Steponeplus real time pcr system, by Thermo Fisher Scientific (6 mentions)
Superase in rnase inhibitor, by Thermo Fisher Scientific (3 mentions)
Quantstudio 1 real time pcr system, by Thermo Fisher Scientific (3 mentions)
Dnase 1, by Takara Bio (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Quantstudio 1, by Thermo Fisher Scientific (1 mentions)
Superase intm rnase inhibitor, by Thermo Fisher Scientific (1 mentions)
Superase 1 rnase inhibitor, by Thermo Fisher Scientific (1 mentions)
9 protocols using one step tb green primescript plus rt pcr kit perfect real time
1
Quantitative RT-PCR for Rubella Virus
2
Quantitative Analysis of Host Cell Stress Response to Rubella Virus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HTR-8/SVneo and Swan.71 cells were cultured in 24-well plates and subjected to LG culture conditions without or with RuV infection (in a viral binding assay), as described above. Total mRNA was extracted using TRIzol reagent (Life Technologies, Tokyo, Japan), and contaminated genomic DNA was removed by treatment with DNAse I (TaKaRa Bio, Inc., Otsu, Japan). Real-time RT-PCR was performed using a One-Step TB Green Prime-Script PLUS RT-PCR Kit (Perfect Real Time; TaKaRa Bio) in a QuantStudio 3 Real-Time PCR System (Applied Biosystems, MA, United States). The following primer sequences were used: GRP78/BiP, sense, 5′-TGT TCA ACC AAT TAT CAG CAA ACT C-3′ and antisense, 5′-TTC TGC TGT ATC CTC TTC ACC AGT-3′; CHOP, sense, 5′-AGA ACC AGG AAA CGG AAA CAG A-3′ and antisense, 5′-TCT CCT TCA TGC GCT GCT TT-3′; RuV, sense, 5′-CCA CTG AGA CCG GCT GCG A-3′; antisense, 5′-GCC TCG GGG AGG AAG ATG AC-3′; and peptidylprolyl isomerase A (PPIA), sense, 5′-ATG CTG GAC CCA ACA CAA AT-3′ and antisense, 5′-TCT TTC ACT TTG CCA AAC ACC-3′. The results were analyzed using the delta–delta Ct method.
3
SARS-CoV-2 RNA Quantification by RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cell culture supernatant was combined with an equal volume of 2×RNA lysis buffer (distilled water containing 0.4 U/μL SUPERase·In RNase Inhibitor (Thermo Fisher Scientific), 2% Triton X-100, 50 mM KCl, 100 mM Tris-HCl (pH 7.4), and 40% glycerol) and incubated at room temperature for 10 min. The mixture was diluted 10 times with distilled water. Viral RNA was quantified using a One-Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (Takara Bio) on a QuantStudio 1 Real-Time PCR System (Thermo Fisher Scientific) and specific primers (SI Appendix, Table S1 ). Standard curves were prepared using SARS-CoV-2 RNA (1 × 105 copies/μL) purchased from Nihon Gene Research Laboratories.
4
SARS-CoV-2 RNA Extraction and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cell culture supernatant was mixed with an equal volume of 2× RNA lysis buffer [distilled water containing SUPERase·In RNase inhibitor (0.4 U/μl; Thermo Fisher Scientific), 2% Triton X-100, 50 mM KCl, 100 mM tris-HCl (pH 7.4), and 40% glycerol] and incubated at room temperature for 10 min. The mixture was diluted 10 times with distilled water. Viral RNA was quantified using the One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (Takara Bio) on a QuantStudio 1 Real-Time PCR System (Thermo Fisher Scientific). The primers used in this experiment are shown in table S1. Standard curves were prepared using SARS-CoV-2 RNA (105 copies/μl) purchased from Nihon Gene Research Laboratories.
5
Quantifying EV71 RNA levels by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT-PCR targeting the VP1 gene of EV71 was performed to test vRNA level. Total RNA was extracted from 300 µL mixture of cells and culture fluid and then eluted into 60 µL RNase-free water using Nucleic Acid (DNA/RNA) Extraction or Purification Kit (SANSURE BIOTECH INC, China). The extracted RNA was detected by One-Step TB Green™ PrimeScript PLUS RT-PCR Kit (Perfect Real-time) (TaKaRa, Kyoto, Japan). The relative RNA expression level was calculated using a classical 2−ΔΔCt method after normalizing against the expression level of β-actin. Sequences of primer pairs are shown in Table 1 .
Primer Pairs Used for Detection of EV71 and Host Cells
| Target | Primer Name | Sequence of Primers |
|---|---|---|
| EV71 | EV71-F | 5’-GAGCATGATTGAGACACGCTGTGT- 3’ |
| EV71-R | 5’-CCCGCCCTRCTGAAGAAACT- 3’ | |
| Host gene (RD) | β-actin-F | 5’-GAGCTACGAGCTGCCTGACG-3’ |
| β-actin-R | 5’-CCTAGAAGCATTTGCGGTGG-3’ |
6
SARS-CoV-2 RNA Quantification by RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cell culture supernatant was mixed with an equal volume of 2×RNA lysis buffer (distilled water containing 0.4 U/μL SUPERase InTM RNase Inhibitor (Thermo Fisher Scientific), 2% Triton X-100, 50 mM KCl, 100 mM Tris-HCl (pH 7.4), and 40% glycerol) and incubated at room temperature for 10 min. The mixture was diluted 10 times with distilled water. Viral RNA was quantified using a One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (Takara Bio) on a StepOnePlus real-time PCR system (Thermo Fisher Scientific) or QuantStudio 1 (Thermo Fisher Scientific). The primers used in this experiment are as follows: (forward) AGCCTCTTCTCGTTCCTCATCAC and (reverse) CCGCCATTGCCAGCCATTC. Standard curves were prepared using SARS-CoV-2 RNA (105 (link) copies/μL) purchased from Nihon Gene Research Laboratories.
7
Quantification of SARS-CoV-2 Viral RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cell culture supernatant was mixed with an equal volume of 2 × RNA lysis buffer (distilled water containing 0.4 U/μL SUPERase ITM RNase Inhibitor (Thermo Fisher Scientific), 2% Triton X-100, 50 mM KCl, 100 mM Tris–HCl (pH 7.4) and 40% glycerol) and incubated at room temperature for 10 min. The mixture was diluted 10 times with distilled water. Viral RNA was quantified using a One Step TB Green PrimeScript PLUS RT-PCR kit (Perfect Real Time) (Takara Bio) on a StepOnePlus real-time PCR system (Thermo Fisher Scientific). The primers used in this experiment are as follows: (forward) AGCCTCTTCTCGTTCCTCATCAC and (reverse) CCGCCATTGCCAGCCATTC. Standard curves were prepared using SARS-CoV-2 RNA (105 copies/μL) purchased from Nihon Gene Research Laboratories.
8
SARS-CoV-2 RNA Quantification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cell-culture supernatant was mixed with an equal volume of 2× RNA lysis buffer (distilled water containing 0.4 U/μL SUPERase•In Rnase Inhibitor (Thermo Fisher Scientific), 2% Triton X-100, 50 mM KCl, 100 mM Tris-HCl (pH 7.4), and 40% glycerol) and incubated at room temperature for 10 min. The mixture was diluted 10 times with distilled water. Viral RNA was quantified using a One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (Takara Bio) on a QuantStudio 1 Real-Time PCR System (Thermo Fisher Scientific). The primers used in this experiment are shown in Supplementary Table 2 . Standard curves were prepared using SARS-CoV-2 RNA (105 copies/μL) purchased from Nihon Gene Research Laboratories.
9
Quantifying SARS-CoV-2 Viral RNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cell culture supernatant was mixed with an equal volume of 2× RNA lysis buffer (distilled water containing 0.4 U/μL SUPERase I RNase Inhibitor [Thermo Fisher Scientific], 2% Triton X-100, 50 mM KCl, 100 mM Tris-HCl [pH 7.4], and 40% glycerol) and incubated at room temperature for 10 min. The mixture was diluted 10 times with distilled water. Viral RNA was quantified using a One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (Takara Bio) on a StepOnePlus real-time PCR system (Thermo Fisher Scientific). The primers used in this experiment are as follows: (forward) AGCCTCTTCTCGTTCCTCATCAC and (reverse) CCGCCATTGCCAGCCATTC. Standard curves were prepared using SARS-CoV-2 RNA (105 copies/μL) purchased from Nihon Gene Research Laboratories.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!