The nuclear fractions were incubated with 15 μL of 50 mM tris‐Cl (Sigma Life Science), 10 mM EDTA (Thermo Scientific), 10 pmol of the respective oligonucleotide (Microsynth, Supporting information Table S2 ), and 0.02 U of UDG (Uracil‐DNA Glycosylase, New England BioLabs) at 37°C for 2 h. Then, the samples were treated with 100 mM NaOH (Sigma Life Science) for 30 min at 37°C to break the DNA backbone at the abasic sites. To neutralize the reaction, 3 μL of 4 N HCl and 37 μL of 2 M tris‐Cl were added. Fluorescence was measured using a Cytation imaging reader (BioTek) with excitation at 490 nm and emission at 520 nm, and the data were analyzed with the Gen5 Software (BioTek).
Tris cl
Manufactured by Merck Group
Sourced in United States, Germany
Tris-Cl is a laboratory reagent that is commonly used as a buffer in various biochemical and molecular biology applications. It is a solution of tris(hydroxymethyl)aminomethane (Tris) and hydrochloric acid (HCl), which is used to adjust the pH of solutions. Tris-Cl helps to maintain a stable pH environment for experiments, ensuring the optimal activity and stability of biomolecules.
Automatically generated - may contain errors
Lab products found in correlation
Sodium chloride (nacl), by Merck Group (6 mentions)
Uracil dna glycosylase, by New England Biolabs (2 mentions)
Ethylene diamine tetraacetic acid (edta), by Thermo Fisher Scientific (2 mentions)
Cytation imaging reader, by Agilent Technologies (2 mentions)
Sodium hydroxide (naoh), by Merck Group (2 mentions)
Triton x 100, by Merck Group (2 mentions)
Sodium dodecyl sulfate (sds), by Merck Group (2 mentions)
Sucrose, by Merck Group (2 mentions)
Mgcl2, by Merck Group (2 mentions)
Sodium deoxycholate, by Merck Group (2 mentions)
Potassium chloride (kcl), by Merck Group (2 mentions)
Pyruvate, by Merck Group (1 mentions)
Glutamine, by Merck Group (1 mentions)
Dulbecco s modified eagle medium, by Merck Group (1 mentions)
Cellrox orange, by Thermo Fisher Scientific (1 mentions)
Mitosox red, by Thermo Fisher Scientific (1 mentions)
Glucose, by Merck Group (1 mentions)
Bovine serum albumin (bsa), by Merck Group (1 mentions)
Protease inhibitor, by Merck Group (1 mentions)
Phenylmethylsulfonyl fluoride, by Merck Group (1 mentions)
18 protocols using tris cl
1
Quantifying DNA Glycosylase Activity
2
Oxidative Stress Assay Reagents
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bovine serum albumin, Dulbecco’s Modified Eagle Medium, glucose, glutamine, NaCl, N-Acetyl-L-Cysteine (NAC), phenylmethylsulfonyl fluoride (PMSF), protease inhibitors, pyruvate, SDS, sodium deoxycholate, tert-butylhydroperoxide (Luperox), tris/Cl, triton X-100, were all purchased from Sigma-Aldrich (St. Luis, MO, USA). CellROX Orange and MitoSOX Red were from (Thermo Fisher Scientific, Waltham, MA, USA).
3
Apoptosis Detection in Calcified Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A cell apoptosis stain was performed to assess the cell death and viability of samples from calcification and miRNA silencing studies. This staining was done using the in situ Cell Death Detection Kit; TMR red, TUNEL kit (Roche Diagnostics, Germany). Cryopreserved tissue sections were fixed with 4% paraformaldehyde (Sigma-Aldrich, MO) in dPBS (pH 7.4) for 20 min, rinsed with dPBS for 30 min, permeabilized with 0.1% Triton X-100 (Sigma-Aldrich, MO) in dPBS (2 min at 4 °C), and rinsed twice with dPBS. Staining was performed by incubating tissue sections for 1 h at 37 °C in a humidified chamber in the dark in 50 μ L of TUNEL reaction mixture followed by counterstaining with DAPI for 5 min. A positive control was prepared by incubating the fixed and permeabilized tissue section with DNAse-I solution (3–3000 U/ml RNAse free DNAse-I (Qiagen, CA) in 50 mM TrisCl (Sigma-Aldrich, MO), pH 7.5, 1 mg/mL BSA (Fisher Scientific, PA) for 10 min prior to labeling with TUNEL reaction mixture. A negative control was prepared by incubating fixed and permeabilized tissue sections in 50 μ l of TUNEL label solution (without terminal transferase). Apoptotic cells appeared red and nuclei appeared blue under fluorescence microscopy.
4
Sphingolipid Standards and Reagents
5
Transposase-based Library Preparation
6
Rapid SARS-CoV-2 Detection using Gold Electrodes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Escherichia coli DH5α, Thermo InsTA cloning kit, Purification kit, primers, LB broth, X-gal, ampicillin, IPTG, autoclave, petri dish. 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC), Methylene Blue, cysteine, N-hydroxysuccinimide (NHS), glucose, Tris–Cl, NaOH pellets, SDS, potassium acetate, glacial acetic acid, EtBr and agarose powder were bought from Sigma Aldrich, USA. Tris(hydroxymethyl) aminomethane (Tris base), sodium di-hydrogen ortho-phosphate, ethanol, EDTA (di-sodium hydrogen ortho-phosphate, ethylenediaminetetraacetic acid), and other materials were purchased from Qualigens. Viral RNA was isolated from samples at microbiology department, PGIMS, Rohtak. All samples were tested using Real-Time PCR (Rotor-Gene Q) from QIAGEN at PGIMS, Rohtak. Complementary DNA was synthesized using Thermo scientific (K1621) and HA gene probe 5′-NH2-linked (GACACTGTAGACACAGTACTAG) was developed by Bio India Life Sciences, India. SPGE (Screen printed gold electrodes-AT220) were obtained from Dropsens. Primer 3 and BLAST were used for primer designing. UV illuminator (MAESTRO GEN) and Bio-Rad gel documentation were used for gel analysis.
7
Immunohistochemical Analysis of Tissue Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse samples, rat IVD tissues and human NP samples were decalcified, dehydrated, cleared with dimethylbenzene after fixation in 4% paraformaldehyde, and specimens were embedded in paraffin. Each slice was cut into 5-μm thick sections, which were pretreated with antigen retrieval buffer (enzymatic digestion) (AR0022; Boster Biological Technology, Wuhan, China) for 30 min at 37°C. After blocking in goat serum for 30 min at room temperature, serial slices were incubated with primary antibodies (listed in Table S5
8
Whole-Cell Protein Extraction and Western Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To prepare whole-cell extracts, cells were scraped from the dishes and suspended in protein extraction buffer (100 mM Tris-Cl (Sigma-Aldrich) pH 7.8, 10 mM NaCl (Sigma-Aldrich), 10% glycerol (Sigma-Aldrich), 1 mM sodium orthovanadate (Sigma-Aldrich), 50 mM sodium fluoride (Sigma-Aldrich), and 1 mM phenymethylsulfonyl fluoride (Sigma-Aldrich). Equal amounts of protein were separated by electrophoresis on 10% SDS-polyacrylamide gels, followed by electrophoretic transfer to nitrocellulose membranes (EMD Millipore). Membranes were blocked in 5% nonfat dry milk (Amresco LLC) and 0.1% Tween-20 (Amresco LLC) in Tris-buffered saline and probed with the following primary antibodies; the anti-ERK, anti-JNK, anti−p38, anti-phospho-JNK, anti-MEK, anti-FLAG, anti-p53, anti-p21, anti-GSK3β, and anti-ACTIN (Santa Cruz Biotechnology), anti-phospho-ERK, anti-phospho-p38, anti-phospho-GSK3β (Ser9), and anti-phospho-MEK (Cell Signaling). Antibody-antigen complexes were incubated with anti-rabbit or anti-mouse-IgG-peroxidase conjugates (Santa Cruz Biotechnology), followed by detection using an enhanced chemiluminescence (ECL) kit (GE Healthcare Life Sciences).
9
Protein Extraction and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissues were carefully pulled out from the frozen tubes, cut into pieces, weighed about 50 mg, added 10 times extraction buffer, and extracted protein with a grinding mill. The extracted samples were spun to remove the residue of tissues. The protein concentration of the extracted sample solution was measured with a BCA Protein Assay kit (Pierce). Proteins extracted from tissue were precipitated with a TCA Protein Precipitation Kit (QYBIO). The protein pellet was dried out by SpeedVac. The pellet was subsequently dissolved with 8 M urea in 100 mM Tris-Cl (pH 8.5, Sigma). Tris(2-carboxyethyl)phosphine (TCEP, final concentration is 5 mM, Thermo Scientific) and iodoacetamide (final concentration is 10 mM, Sigma) were added to the solution and incubated at room temperature for 20 and 15 minutes for reduction and alkylation, respectively. The solution was digested with LysC at 1 : 100 (w/w) (Promega) for 4 h and then diluted four times and digested with trypsin at 1 : 50 (w/w) (Promega) for 16 h. The digested peptide mixtures were labelled with the TMT kit (6-plex, Thermo).
10
Cloning and Protein Overexpression Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
E. coli DH5α was used for cloning, and E. coli BL21(DE3) was used for protein overexpression. Luria-Bertani broth, Tris-Cl, sodium chloride salts, and imidazole salts were purchased from Sigma-Aldrich. Powder forms of all β-lactams (Table 1 ) were procured from Sigma-Aldrich. Penem T405 was synthesized as described (42 (link)).
+ Expand
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!