Citrate

Citrate and trisodium Citrate dihydrate were obtained from Sinopharm Chemical Reagent Co., Ltd. The sodium Citrate buffer (100 mmol/L, pH = 3) was prepared by mixing 100 mmol/L Citrate acid and sodium Citrate. The 28‐nt Cy3‐labelled ODN (5′‐3′ sequence: TTGCACATGCCGGAGCCGTTGTCGACGA) was synthesized and purified by Sangon Biotech (China). All chemicals and reagents were of analytical grade.

The roots of AB were collected in Jiaozuo City, Henan Province in November 2020 (batch number: 20201114) and authenticated by Professor Ping Wang. Voucher specimens of the herb was deposited in the Moganshan campus of Zhejiang University of Technology. D₂O (99.9% D) was purchased from Sigma Co. (Darmstadt, Germany). K₂HPO₄ and NaH₂PO₄ were obtained from Xilong Chemical Co (Huanggu County, Shenyang, China). Phosphate buffer solution (pH 7.4) was prepared by dissolving 50 mM K₂HPO₄/NaH₂PO₄ in the D₂O. Standard substances, including L-valine, L-serine, L-proline, d-mannose, L-alanine, L-cysteine, L-leucine, L-lysine, L-threonine, L-aspartate, L-phenylalanine, and palmitic acid were obtained from Shanghai Ryon Biological Technology Co (Qingpu County, Shanghai, China). Citrate, succinic acid, glycine, glucose, cholesterol, and stearate and were purchased from Sinopharm Chemical Reagent Co (Jingan County, Shanghai, China).