M mlv rt 50.000 u

RNA from whole cell lysates was isolated using the ReliaPrep™ RNA Miniprep System (Promega, Madison, WI, USA), according to the manufacturers’ protocol. For mRNA reverse transcription, 1μg of RNA was transcribed using the following reagents: 5× RT buffer and M-MLV RT 50.000 U (Promega), dNTP Mix (Promega), random hexamer primer (ThermoFisher Scientific), and RiboLock (Thermo Fisher Scientific). Reverse transcription was carried out at 25 °C for 5 min, 40 °C for 60 min, and 70 °C for 10 min. Sybr green-based real-time PCR (Maxima SYBR Green/ROX qPCR Master Mix, Thermo Fisher Scientific) was performed with the following protocol: 10 min at 95 °C followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C, followed by 15 s at 95 °C, 1 min at 60 °C and 15 s at 95 °C. Individual samples were run in triplicates. The following primers were used: hNPNT fw: GGAGGCAAACACAGATCACC, hNPNT rev: TCCAATCTCCCCAGTGTGAC, hHPRT fw: GACCAGTCAACAGGGGACAT, and hHPRT rev: AACACTTCGTGGGGTCCTTTTC. Data was analyzed by using the ΔΔCt method.

RNA from whole cell lysates was isolated using the ReliaPrepTM RNA Miniprep System (Promega, Madison, WI, USA), according to the manufacturers’ protocol. For mRNA reverse transcription, 1 μg of RNA was transcribed using the following reagents: 5× RT buffer and M-MLV RT 50.000 U (Promega, Madison, WI, USA), dNTP Mix (Promega, Madison, WI, USA), random hexamer primer (ThermoFisher Scientific, Waltham, MA, USA), and RiboLock (Thermo Fisher Scientific, Waltham, MA, USA). Reverse transcription was carried out at 25 °C for 5 min, 40 °C for 60 min and 70 °C for 10 min. Sybr green-based real-time PCR (Maxima SYBR Green/ROX qPCR Master Mix, Thermo Fisher Scientific, Waltham, MA) was performed with the following protocol: 10 min at 95 °C followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C, followed by 15 s at 95 °C, 1 min at 60 °C and 15 s at 95 °C. Individual samples were run in triplicates. The following primers were used
Data were analyzed by using the ΔΔCt method.