Three common mutations in the β-globin gene (CD41/42, IVS1-5 and IVS2-654) were studied. Two separate AS-PCR assays were carried out for each mutation: one amplified only the normal allele, while the other amplified only the mutant allele. The amplification reagents for the 50 µL PCR reactions consisted of 1X HotstarTaq Plus PCR buffer, 0.8 mM deoxyribonucleotide triphosphates, 0.5 µM forward and reverse primers (see online supplementary table S1), 0.1 unit HotstarTaq Plus (Qiagen, Germany), 500 ng parental and their respective CV DNA. The amplification was carried out with a denaturation and enzyme activation step at 95°C for 5 min, followed by 40 cycles of denaturation at 94°C for 1 min, an appropriate annealing temperature (see online supplementary table S1) for 45 s, extension at 72°C for 90 or 120 s with a final extension at 72°C for 10 min. Sequencing was carried out with the same pair of amplification primers using the BigDye Terminator V.3.1 Cycle Sequencing Kit (Applied Biosystems).
Hotstartaq plus
Manufactured by Qiagen
Sourced in Germany, United Kingdom, United States
HotStarTaq Plus is a DNA polymerase designed for hot-start PCR amplification. It provides increased specificity and sensitivity compared to standard Taq DNA polymerase.
Automatically generated - may contain errors
Lab products found in correlation
Phosphate buffered saline (pbs), by Merck Group (4 mentions)
Qiaquick pcr purification kit, by Qiagen (3 mentions)
Nextera xt index adapters, by Illumina (3 mentions)
Miseq system, by Illumina (3 mentions)
Potassium ferrocyanide, by Merck Group (3 mentions)
4 aminobenzoic acid, by Merck Group (3 mentions)
Dg8tm cartridge, by Bio-Rad (3 mentions)
Phusion direct pcr kit, by Thermo Fisher Scientific (3 mentions)
Supermix for probes, by Bio-Rad (3 mentions)
Potassium ferricyanide, by Merck Group (3 mentions)
Hydrochloric acid (hcl), by Merck Group (3 mentions)
Potassium chloride (kcl), by Merck Group (3 mentions)
Sodium chloride (nacl), by Merck Group (3 mentions)
Sodium nitrate, by Merck Group (3 mentions)
Ethanolamine, by Merck Group (3 mentions)
N hydroxysuccinimide, by Merck Group (3 mentions)
Droplet generation oil, by Bio-Rad (3 mentions)
Nucleospin tissue kit, by Macherey-Nagel (3 mentions)
Q solution, by Qiagen (2 mentions)
Cfx thermal cycler, by Bio-Rad (2 mentions)
33 protocols using hotstartaq plus
1
Detecting Common β-Globin Mutations
2
Bisulfite Sequencing of Glucocorticoid Receptor Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR was carried out for each DNA sample as nine separate amplification reactions, each containing a single set of GR bisulfite sequencing primers. Primary reactions contained 5–10 ng bisulfite-converted DNA, 0.5 units HotStarTaq Plus DNA polymerase (Qiagen), 1X PCR buffer (Qiagen), 0.2 mM dNTPs, and 0.2 μM forward and reverse primers in a 25 μL volume. PCR conditions were 95 °C for 10 min followed by 40 cycles of denaturing at 95 °C for 30 s, annealing at 55 °C for 45 s, elongation at 72 °C for 30 s, followed by a final extension at 72 °C for 7 min. Secondary PCR for sample barcoding was performed in 50 μL reactions using 2 μL primary PCR product, 0.5 U Qiagen HotStarTaq Plus (Qiagen), 1X PCR buffer (Qiagen), 0.2 mM dNTPs, 3 mM MgCl2, and 0.08 μM of forward (barcoded) and reverse sequencing primers. PCR conditions were 95 °C for 15 min followed by 5 cycles of denaturing at 95 °C for 30 s, annealing at 58 °C for 30 s, elongation at 72 °C for 30 s, followed by a final extension step at 72 °C for 7 min. Equal volumes of secondary PCR products from each GR bisulfite sequencing primer set were pooled together by sample and purified with Agencourt AmpureXP magnetic beads (Beckman Coulter). Sample libraries were combined in equimolar concentrations and then sequenced on an Ion Torrent platform.
3
DNA Extraction and PCR Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA extractions were performed with the QiaAmp DNA Mini kit (Qiagen Inc.) according to the manufacturer's tissue protocol. Each PCR contained 2.5 µL 10X buffer, 0.5 µL dNTPs (New England Biolabs Ltd., Whitby, Canada), 1 µL 10 µM forward primer, 1 µL 10µM reverse primer, 0.2 µL 5 U/µL Qiagen Hot Star Taq Plus (Qiagen Inc., Mississauga, Canada), 15 µL distilled nuclease free water and 1 µL template DNA. The thermal profile used was 95°C for 5 min, followed by 35 cycles of 94°C for 30 s, target-specific annealing temperature for 30 s, and 72°C for 1 min, followed by 72°C for 10 min. Amplified PCR products were purified using either Pall Life Sciences Multi-Well Plate Manifolds (Pall Corporation, Port Washington, WI, USA) or the QIAquick PCR purification kit (Qiagen Inc.). Target-specific annealing temperatures were as recommended by the primer selection software. PCR products were analyzed using 1.5% agarose gel electrophoresis.
4
High-throughput BCR Sequencing of Sorted Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BCR Sequencing was carried out as described previously (37 (link)). Briefly, whole transcriptome amplification (WTA) was performed on the sorted cell-lysates according to the Smart-Seq2 protocol (105 (link)). We then amplified heavy and light chain sequences from the WTA products utilizing pools of partially degenerate pools of V region specific primers (Qiagen HotStar Taq Plus). Heavy and light chain amplifications were carried out separately, with each pool containing pooled primers against human IGHV and heavy chain constant region genes, or human IGLV, IGKV, and light chain constant region genes. Cellular barcodes and index adapters (based on Nextera XT Index Adapters, Illumina Inc.) were added using a step-out PCR method. Amplicons were then pooled and sequenced using a 250×250 paired end 8×8 index reads on an Illumina Miseq System. The data were then demultiplexed, heavy and light chain reads were paired, and overlapping sequence reads were obtained (Panda-Seq) (106 (link)) and aligned against the human IMGT database (107 (link)).
5
LAPTM4B Genotyping by PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total genomic DNA was isolated from peripheral white cells using Blood Genomic DNA extraction kit following the manufacturer’s instructions (Tiangen Beijing, China). DNA was dissolved in elution buffer, and its concentration was measured with a Nanodrop 2000 spectrophotomer (Thermo Fisher Scientific, Wilmington, Delaware, USA) and stored at -80°C until use.
Genotype of LAPTM4B was identified by PCR analysis using the primers 5’-GCCGACTAGGGGACTGGCGGA-3’ (sense) and 5’-CGAGAGCTCCGAGCTTCTGCC-3’ (antisense). PCR was carried out on a thermo cycler (Gene Cycler TM, Bio-Rad, CA, USA) in 20-μl volumes as follows: denaturation at 95°C for 5 min, followed by 35 cycles of 94°C for 30s, 65°C for 30s, 72°C for 30s. The last cycle was followed by auto-extension 72°C for 7 min with Taq DNA polymerase (Hotstar Taq plus, Qiagen, Valencia, California, USA). The amplified products were analyzed by electrophoresis in 10% polyacrylamide gel (visualized by gel-red).
Genotype of LAPTM4B was identified by PCR analysis using the primers 5’-GCCGACTAGGGGACTGGCGGA-3’ (sense) and 5’-CGAGAGCTCCGAGCTTCTGCC-3’ (antisense). PCR was carried out on a thermo cycler (Gene Cycler TM, Bio-Rad, CA, USA) in 20-μl volumes as follows: denaturation at 95°C for 5 min, followed by 35 cycles of 94°C for 30s, 65°C for 30s, 72°C for 30s. The last cycle was followed by auto-extension 72°C for 7 min with Taq DNA polymerase (Hotstar Taq plus, Qiagen, Valencia, California, USA). The amplified products were analyzed by electrophoresis in 10% polyacrylamide gel (visualized by gel-red).
6
PCR Amplification and Mutation Screening
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR reaction mixes contained DNA polymerase [either HotStar Taq Plus (Qiagen) or Phusion Polymerase (Fermentas)], 1.5–3 mM MgCl2, 400 μM dNTPs, 200 μM of each primer, 1× reaction buffer (according to the enzyme used), 1–2 µl of DNA template in final volume of 25 or 50 µl. Cycling conditions included an initial hot start at 95°–98° for 30 sec to 2 min, 35–40 cycles of 95°–98°/30 sec; 60°–68°/1 min; 72°/1–2.5 min, plus a final 72° extension for 5–10 min.
Unless otherwise stated, restriction enzymes were from New England Biolabs. In general, restriction digest reactions to screen for mutations, were incubated for 1–3 hr at 37° and heat-inactivated if necessary according to the manufacturer’s instructions. SeeTable S2 for primer and enzyme combinations used for individual screening assays.
Unless otherwise stated, restriction enzymes were from New England Biolabs. In general, restriction digest reactions to screen for mutations, were incubated for 1–3 hr at 37° and heat-inactivated if necessary according to the manufacturer’s instructions. See
7
Extraction and Characterization of Lens Epithelial Cell RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from lens epithelial cells adherent to the lens capsule using the RNeasy Micro Kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol. RNA from blood collected in Tempus Blood Collection Tubes (Applied Biosystems, Foster City, CA) was extracted using the Tempus Blood RNA Extraction Kit (Applied Biosystems) according to the manufacturer’s protocol. From RNA, cDNA was synthesized using Superscript III reverse transcriptase (Invitrogen, Carlsbad, CA) and random hexamers. Reverse transcription PCR (RT–PCR) was performed on cDNA templates using gene-specific primers and HotStarTaq Plus (Qiagen) under the following conditions: enzyme activation at 95 °C 5 min; 30–45 cycles of denaturation at 95 °C 30 s, annealing at 56 °C 30 s, and elongation at 72 °C 30 s, followed by extension at 72 °C 5 min. The primer sequences used for amplification of each gene are listed in Appendix 1. The resulting PCR products were analyzed with agarose gel electrophoresis. Specificity of the amplified products was confirmed with sequencing.
8
Predesigned Overlapping Oligodeoxynucleotides Assembly
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Predesigned overlapping oligodeoxynucleotides (Supplemental Fig. S1 and Supplemental Table S1 were assembled by PCR (BioRAD T100) using Primers F1, R1, F2, and R2 (Supplemental Fig. S1 ; Supplemental Table S2 )). The PCR reaction was carried out in a fixed volume of 100 µL, containing primers F1 (2 µM), R1 (0.2 µM), F2 (0.2 µM), R2 (2 µM), Taq polymerase (hotStar Taq Plus from QIAGEN) with its reaction buffer at 1×, Q-solution (1× from QIAGEN), 0.2 mM of dNTPs (DGel electrosystem) and Milli-Q water. The reaction mixture was subjected to 15 min denaturation at 95°C and 15 cycles consisting of: 30 sec denaturation at 95°C, 30 sec annealing at 50°C and 30 sec extension at 72°C. PCR was validated by visualizing 5 µL of reaction mixture on 2% agarose gel containing gel red (Trans). The remaining PCR product was ethanol precipitated.
9
Sanger Sequencing Validation of NGS Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For Sanger sequencing verification of genotypes called by NGS, oligo-nucleotide primers were synthesized by Integrated DNA Technologies. The regions containing the suspected single nucleotide variants (SNVs) were amplified by polymerase chain reaction (PCR) using 50 ng of genomic DNA derived from patient peripheral blood, the listed primers and Qiagen HotStar Taq Plus under the following conditions: 95 °C x 5 min denaturation followed by 40 cycles of 95 °C x 30 s, 55 °C x 30 s, 72 °C x 30 s. Residual primers and nucleotides were removed with ExoSAP-IT reagent (USB, Cleveland, OH, USA). The amplicons were then sequenced using BigDye® terminator chemistry by Macrogen (Rockville, MD) and compared to Human Genome reference sequence (GRCh37; assembly hg19) using Sequencher (GeneCodes, Ann Arbor, MI, USA).
10
CpGRASP Protein Expression and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To clone the CpGRASP coding sequence, the following forward primer CCGGATCC GGAGGTGCGCAAACCAAAC including BamHI restriction site (underlined) and reverse primer CTCCCGGG TTATATTTCTCCTTGGTCTGTG including SmaI restriction site (underlined) were used. PCR amplification was performed with Hot Star Taq Plus (Qiagen) using 5 ng of genomic DNA as template and these PCR conditions: 95°C for 5 min, 35 cycles of 94°C for 15 sec, 55°C for 15 sec, 72°C for 4 min, and a final extension at 72°C for 10 min. Reactions were conducted in a Veriti 96 well thermal cycler (Applied Biosystem). The amplified fragment was digested with BamHI and SmaI restriction enzymes and ligated in pQE80 vector (Qiagen) digested with the same enzymes, using Quick Ligase kit (New England Biolabs). Ligation was used to transform E. coli M15 host strain, positive colonies were selected by PCR screening, and amplicons were sequenced to verify the fusion of histidine tag at the 5’-end of the inserted CpGRASP sequence. The histidine-tagged CpGRasp (6His-CpGRASP) was then purified as above.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!