Cd34 progenitor cell isolation kit

Human cord blood CD34 ⁺ cells were separated from human cord blood mononuclear cells (Stemcyte, Covina, CA) by a CD34 ⁺ progenitor cell isolation kit (Miltenyi Biotec, North Rhine-Westphalia, Germany). Human cord blood-derived MCs were induced from cord blood CD34 ⁺ cells as described previously [16 (link)].

The study was approved by the ethics evaluation committee of INSERM, institutional review board (IRB00003888) of the French institute of medical research and health (IORG0003254 FWA00005831). CB cells were obtained from Saint-Louis Hospital (Paris, France). mPB cells were collected from the residual cells in bags prepared for transplantation at Pitié Salpêtrière Hospital (Paris, France). Adult bone marrow cells were obtained from hip operations at the “Centre Hospitalier Intercommunal” (Créteil, France). The mononuclear cell fractions were isolated by gradient separation, and human CD34⁺ cells were isolated with the CD34⁺ progenitor cell isolation kit (Miltenyi Biotech, Paris, France) and the autoMACSPro instrument (Miltenyi Biotec).

Peripheral blood mononuclear cells were isolated from blood samples after Pancoll fractionation (PAN Biotech). CD34⁺ cells were then isolated by a magnetic sorting system (Miltenyi Biotec CD34 Progenitor cell isolation kit) following the supplier protocol. CD34⁺ cells were placed in an in vitro two-phase liquid culture system, as previously described.^{10 (link)} For detailed protocols please refer to the Online Supplementary Appendix.
For cultures treated with pomalidomide, cells were incubated with 1 mM pomalidomide (Sigma) as previously described,^{11 (link)} starting from day 1 (D1) of phase II of culture. For γ-globin derepression experiments using CRISPR/Cas9, patient CD34⁺ cells were immunoselected and cultured for 48 hours (h) and then electroporated with ribonucleoprotein (RNP) complexes containing Cas9-GFP protein (4.5 mM) and the -197 guide RNA (gRNA) targeting both HBG1 and HBG2 γ-globin promoters (5’ ATTGAGATAGTGTGGGGAAGGGG 3’; protospacer adjacent motif in bold) or a gRNA targeting the Adeno-associated virus integration site 1 (AAVS1; 5’ GGGGCCACTAGGGACAGGATTGG 3’; protospacer adjacent motif in bold).^{12 (link)} Cleavage efficiency was evaluated in cells harvested 6 days after electroporation by Sanger sequencing followed by tracking of indels by decomposition (TIDE) analysis.^{13 (link)}