Total RNA was extracted from 1.0 g of cotton fiber of DCF, LCF and WCF using RNA Purification Kit according to the manufacturer’s protocol (Sangon Biotech, Shanghai, China). The RNA-seq sequencing and assembly were conducted by the MetWare Technologies Corporation (Wuhan, China). The Agilent 2100 BioAnalyzer was used to detect the fragment size and concentration of the library. The combined probe anchoring polymerization (CPAS) technique was used for sequencing, and the read length of 150 bp was obtained. The library was constructed and sequenced on the Illumina HiSeq 2500 platform [41 (link)]. Following the removal of low-quality sequence reads, clean reads were mapped to the reference genome sequence (https://www.cottongen.org (accessed on 14 January 2021)) using HISAT2 program.
Rna purification kit
Manufactured by Sangon
Sourced in China
The RNA purification kit is a laboratory tool designed to isolate and purify RNA molecules from various biological samples. It utilizes a silica-based membrane technology to efficiently capture and purify RNA, allowing for its subsequent analysis and downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (1 mentions)
Hiseq 2500 platform, by Illumina (1 mentions)
Pcr master mix kit, by Toyobo (1 mentions)
Sybr green mix, by Roche (1 mentions)
Rt pcr kit, by Sangon (1 mentions)
Tb green premix, by Takara Bio (1 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (1 mentions)
Sirnas, by Qiagen (1 mentions)
Mmessage mmachine high yield capped rna transcription kit, by Thermo Fisher Scientific (1 mentions)
5 protocols using rna purification kit
1
Cotton Fiber RNA-seq Profiling
2
Quantitative Analysis of Chondrocyte Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from NP cells was extracted using an RNA purification kit (Sangon, RN001) following the manufacturer’s protocols. A PCR master mix kit (Toyobo, 0910–012700) was used to remove the genomic DNA and to reverse-transcribe RNA into complementary DNA (cDNA). Custom-designed primers targeting mRNA encoding IL-6, type II collagen, and visfatin were synthesized for qPCR. PCR using primers and cDNA templates was performed with SYBR Green Mix (Roche, 47,138,600). Glyceraldehyde 3-phosphate dehydrogenase was used as an internal control. The relative mRNA expression levels were quantified using the 2-ΔΔCt method. All RT-qPCR experiments were carried out in triplicates. The primer sequences used are listed in (Table 2 ).
Primer sequences (human)
| Gene | Forward prime (5ʹ-3ʹ) | Reverse prime (5ʹ-3ʹ) |
|---|---|---|
| IL-6 | ACTCACCTCTTCAGAACGAATTG | CCATCTTTGGAAGGTTCAGGTTG |
| Visfatin | GTGACTTAAGCAACGGAGCG | GGAGGATGTTGAACTCGGCT |
| Aggrecan | GCACAGCCACCACCTACAAAC | CTTTGGCATTCGGCGGACAA |
| Collagen II | ATGAGGGCGCGGTAGAGAC | TCACAGACACAGATCCGGCA |
| MMP3 | GGTTCCGCCTGTCTCAAGAT | AGGGATTTGCGCCAAAAGTG |
| ERK1/2 | TACACCAACCTCTCGTACATCG | CATGTCTGAAGCGCAGTAAGATT |
| JNK | TGTGTGGAATCAAGCACCTTC | AGGCGTCATCATAAAACTCGTTC |
| p38 | CCAGGGGCTGAGCTTTTGAA | TCGGCCACTGGTTCATCATC |
| GAPDH | GACAGTCAGCCGCATCTTCTT | AATCCGTTGACTCCGACCTTC |
3
RNA Extraction and RT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We obtain the total RNA using RNA Purification Kit (Sangon Biotech, China) and assess the concentration and purity of the total RNA samples in a UV spectrophotometer. The primers for Fbxo21, Nr2f2 and Gapdh were as follows: Fbxo21 (forward 5'-CACGTTCCTTGTAATGGCTTCA-3', reverse 5'-ACGACTCATAGTCATCTGGCTG)-3'; Nr2f2 (forward 5'-TCATGGGTATCGAGAACATTTGC-3', reverse 5'-TTCAACACAAACAGCTCGCTC-3'); Gapdh (forward 5'-GGAGCGAGATCCCTCCAAAAT-3', reverse 5'-GGCTGTTGTC-ATACTTCTCATGG-3'). All experimental procedures were performed according to the instructions in the RT-PCR Kit (Sangon Biotech, China).
4
Quantifying icaA Gene Expression in S. aureus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
S. aureus isolates were cultured in TSB at 37°C for 9 hours. Total RNA was extracted using the Sangon Biotech RNA purification kit. The quality and integrity of total RNA were assessed using a NanoDrop spectrophotometer (Thermo Fisher Scientific, MA, USA) and agarose gel electrophoresis. Reverse transcription was carried out using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara) following the manufacturer’s protocol. RT-qPCR amplification reactions were prepared in a final volume of 20 μL, containing 400 ng of cDNA, 10 μL of TB GreenTM premix (Takara), 0.5 μL each of forward and reverse primers (10 nM each), and nuclease-free water to reach the final volume of 20 μL. The primer sequences used for icaA are provided in Table 1 . The relative RNA expression changes of target genes were calculated using the 2−ΔΔCt formula.15 (link) RT-qPCR was performed on a QuantStudioTM 5 Real-Time PCR System, and each reaction was run in triplicate.
5
RNA Synthesis and Microinjection for Cellular Imaging
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In vitro synthesis of RNA was performed using the mMessage mMachine High Yield Capped RNA Transcription Kit (Ambion, AM1340) to produce SP6-promotor driven RNA from linearised plasmid DNA templates following the manufacturer’s instructions. RNA was purified using the RNA purification kit (Sangon Biotech, B511361-0100). RNAs were diluted in injection buffer (5 mM Tris, 5 mM NaCl, 0.1 mM EDTA, pH 7.4) and microinjected into presumptive zygotes as follows: Membrane-GFP, LAMP1-3xeGFP, LAMP1-mScarlet, L10A-eGFP, Emerald-Sec61β, eGFP-eIF2β, PABPC1-eGFP, ANXA11-mEmerald, mScarlet-Borcs7, RPS6-mScarlet, HTATSF1-mScarlet, 24xGCN4_v4-Cdx2-24xPP7, 24xGCN4_v4-eIF2β−24xPP7, ScFv-sfGFP at 35 ng; eGFP-MAP2c, G3PB1-eGFP, mTFP-Utrophin, BFP-Utrophin, PCP-2xmCherry, eGFP-Rab11a at 30 ng. ANXA11-R346C-mEmerald was microinjected at 90 ng. siRNAs (Qiagen) were microinjected at 400 nM described in Table S1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!