Small pool PCR (spPCR) used 50 pg of genomic DNA per reaction. Each spPCR occurred in the presence of HotStart Taq polymerase MasterMix (Qiagen). Amplification conditions were 95° (15 min); 35 cycles of 94° (1 min), 54° (45 s), 72° (1 min); final 72° (7 min). PCR products were resolved on 8% polyacrylamide gels stained with GelRed (Biotium). Images were obtained on a Fuji LAS-3000. See Supplementary Table S1 for PCR primers used in this work.
Inverse PCR (iPCR) samples were derived from CTG102 cell DNA that had been treated with siFANCJ and APH (0.2 μM). DNA (2.5 ug) was digested with an excess of MSEI (New England BioLabs, Inc.) for 1 h at 37° in a 50 μl total volume reaction. After a 20-min heat inactivation at 65°, 10 μl of the reaction was diluted to 1 ng/ul DNA and used for ligation in the presence of T4 DNA ligase (New England BioLabs, Inc.) for 1 h at 16°. The ligation reaction products were cleaned using the MinElute Reaction Cleanup Kit (Qiagen). Amplification used inverse PCR primers (CGCTCAGTGGAACGAAAACT, AGACCCCGTAGAAAAGATCAAAGGA) and HotStart Taq polymerase MasterMix (15 min at 95°; 35 cycles of 1 min at 94°, 45 s at 58°, 1 min at 72°; final 7 min at 72°). iPCR products were cleaned with a Cycle Pure Kit (Omega D6492) and used for next generation sequencing.
Inverse PCR (iPCR) samples were derived from CTG102 cell DNA that had been treated with siFANCJ and APH (0.2 μM). DNA (2.5 ug) was digested with an excess of MSEI (New England BioLabs, Inc.) for 1 h at 37° in a 50 μl total volume reaction. After a 20-min heat inactivation at 65°, 10 μl of the reaction was diluted to 1 ng/ul DNA and used for ligation in the presence of T4 DNA ligase (New England BioLabs, Inc.) for 1 h at 16°. The ligation reaction products were cleaned using the MinElute Reaction Cleanup Kit (Qiagen). Amplification used inverse PCR primers (CGCTCAGTGGAACGAAAACT, AGACCCCGTAGAAAAGATCAAAGGA) and HotStart Taq polymerase MasterMix (15 min at 95°; 35 cycles of 1 min at 94°, 45 s at 58°, 1 min at 72°; final 7 min at 72°). iPCR products were cleaned with a Cycle Pure Kit (Omega D6492) and used for next generation sequencing.