Sybr green pcr master mix

To validate the results of miRNAs from high-throughput sequencing, qRT-PCR was performed using SYBR Green PCR Master Mix on qTOWER 2.2 (Analytik Jena AG). The small RNAs were extracted from leaves of foxtail millet using the miRNA pure Mini kit (Beijing ComWin Biotech). The miRNA cDNA kit (Beijing ComWin Biotech) was used in the reverse transcription reaction. Quantitative real time PCR was performed using the miRNA Real-Time PCR Assay kit (Beijing ComWin Biotech). Each PCR reaction consisted of 2 μl of product from the diluted reverse transcription reaction, 0.5 μl sequence-specific forward primer, 0.5 μl universal reverse primer, 12.5 μl of 2 × miRNA qPCR premix (with SYBR and ROX), and 9.5 μl of nuclease-free water. The U6 gene was used as an internal control. The reaction conditions were set as follows: 95 °C for 10 min followed by 40 cycles of 95 °C for 15 seconds and 60 °C for 1 minute, with a final dissociation curve analysis. All reactions were performed with three biological replicates for each sample (primer list in Additional file 2). Real-time PCR data analysis was performed by qPCR soft 3.0 (Analytik Jena AG).

Quantitative real-time reverse transcription-PCR was performed according to manufacturing instruction (qTower, Analytik Jena, Germany). Briefly, total RNA was isolated from cells using RNeasy kit from Qiagen. cDNA was generated by reverse-transcription of equivalent quantities of RNA using ProtoScript® II first strand cDNA synthesis kit (New England Biolabs, Germany) and qRT-PCR was performed using SYBR Green PCR master mix on qTower (Analytik Jena)^{29 (link)}. The primers were purchased from Eurofins (Germany) and the sequences were listed below. Actin was used as an endogenous control. p21 (5s: gacaccactggagggtgact; 3as: caggtccacatggtcttcct), DR5 (5s: gagctaagtccctgcaccac; 3as: ccccactgtgctttgtacct), p73 (5s: catggagacgaggacacgta; 3as: gtgactcggcctctgtagga); p63 (5s: gaaacgtacaggcaacagca; 3as: gctgctgagggttgataagc). Actin (5s: ctgactacctcatgaagatcctc; 3as: cattgccaatggtgatgacctg)