Genomic DNA (obtained from a 2 mm ear punch collected at post-natal day (P) 14) was extracted using DirectPCR Lysis Reagent (Tail) (Viagen Biotech, Los Angeles, CA) and PCR Grade Proteinase K (Sigma-Aldrich) according to the manufacturer’s protocol. Briefly, the ear punch sample was placed in 100 μL DirectPCR Lysis Reagent (Tail) (Viagen Biotech, Los Angeles, CA) containing 1 μL PCR Grade Proteinase K. The sample was incubated overnight at 55°C, and subsequently incubated at 85°C for 45 min. Two separate PCR reactions were needed to properly describe each individual animal: one detected the Gclc(wt) and Cre(Tg) alleles (Fig. 1A ; left lane for each mouse), and the other detected the Gclc(f) allele (Fig. 1A ; right lane for each mouse). Gclc alleles were determined using 5′-CTATAATGTCCTGCACTGGG and 5′-TAGTGAACGCTGTTAAAGG and 5′-CGGGTGTTGGGTCGTTTGT and the presence of the Cre transgene was identified using 5′-GCGGTCTGGCAGTAAAAACTATC and 5′-GTGAAACAGCATTGCCACTT, as previously described27 (link).
Directpcr lysis reagent tail
Manufactured by Viagen Biotech
Sourced in United States
The DirectPCR Lysis Reagent (Tail) is a laboratory product designed for the efficient lysis of small animal tissue samples, particularly tails, prior to PCR analysis. It is a ready-to-use solution that facilitates the rapid extraction of DNA from these samples, enabling downstream genetic testing and research applications.
Automatically generated - may contain errors
Lab products found in correlation
Proteinase k, by Thermo Fisher Scientific (5 mentions)
C57bl 6j mice, by Jackson ImmunoResearch (2 mentions)
Bigdye terminator cycle sequencing kit v3, by Thermo Fisher Scientific (1 mentions)
Takara la taq dna polymerase, by Takara Bio (1 mentions)
Abi3500 capillary sequencer, by Thermo Fisher Scientific (1 mentions)
Exosap it, by Thermo Fisher Scientific (1 mentions)
Gotaq green master mix, by Promega (1 mentions)
Proteinase k, by Merck Group (1 mentions)
Hotstartaq dna polymerase, by Qiagen (1 mentions)
Purelink genomic dna mini kit, by Thermo Fisher Scientific (1 mentions)
Nucleospin dna ffpe xs, by Macherey-Nagel (1 mentions)
Proteinase k solution, by Thermo Fisher Scientific (1 mentions)
Seqscape software, by Thermo Fisher Scientific (1 mentions)
Abi 3500xl, by Thermo Fisher Scientific (1 mentions)
Directpcr lysis reagent, by Thermo Fisher Scientific (1 mentions)
Accupower pcr premix, by Bioneer (1 mentions)
Proteinase k, by Qiagen (1 mentions)
Dntp mix, by Thermo Fisher Scientific (1 mentions)
Phusion hf buffer, by Thermo Fisher Scientific (1 mentions)
Phusion hot start 2 high fidelity dna polymerase kit, by Thermo Fisher Scientific (1 mentions)
16 protocols using directpcr lysis reagent tail
1
Genomic DNA Extraction and Genotyping Protocol
2
Genotyping Protocol for Patl2 Knockout and HA-Tagged Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA for genotyping was isolated from tail biopsies. Tail biopsies (2 mm long) were digested in 200 μl lysis buffer (Direct PCR Lysis Reagent (Tail); Viagen Biotech inc, CA, USA) and 0.2 mg proteinase K for 12–15 h at 55°C, followed by 1 h at 85°C to inactivate proteinase K. The DNA was directly used to perform PCRs. Multiplex PCR was done for 35 cycles, with an annealing temperature of 62°C and an elongation time of 45 s at 72°C. PCR products were separated by 2% agarose gel electrophoresis. Genotypes were determined depending on the migration pattern. Primers for Patl2‐KO and Patl2‐HA‐tagged mice are listed in Appendix Table S1B,C .
3
Genotyping Mouse Tail DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse tail DNA for initial genotyping of pups was isolated using DirectPCR Lysis Reagent (Tail) (Viagen Biotech, Los Angeles, CA) containing proteinase K (Merck, Darmstadt, Germany) according to the manufacturer’s instructions. PCRs were performed with GoTaq Green Master Mix (Promega, Madison, WI) by using the following primers: R122C forward: 5’-GGAGAGTTTTCTCGCAGGTTC-3’, reverse: 5’-GTACCTGAAGAAGCCTCCAGC-3’; tdTomato forward: 5’-CTGTTCCTGTACGGCATGG-3’, reverse: 5’-GGCATTAAAGCAGCGTATCC-3’; and Iqgap3-intact forward: 5’-CAGCTGCAGTATGAGGGTGT-3’, reverse: 5’-GGTAATGGAGAAGCGCAGCAGCC-3’.
For genotyping by Sanger sequencing, PCR products were amplified using TaKaRa LA Taq DNA Polymerase (Takara, Kusatsu, Japan), were treated with ExoSAP-IT (USB Corporation, Cleveland, OH), and then labeled with the BigDye Terminator Cycle Sequencing Kit v3.1 (Life Technologies, Carlsbad, CA) using the same PCR primers as in the amplification reactions. Sequencing products were loaded on an ABI3500 capillary sequencer (Life Technologies). The following primers were used for sequencing: R122C_seq forward: 5’-TGATGGCCGGCAATGATGAGAACTACTCCG-3’, reverse: 5’-GCGGCCGCAGCACCGGAGACTTCAGAAGTTGCTAAACC-3’.
For genotyping by Sanger sequencing, PCR products were amplified using TaKaRa LA Taq DNA Polymerase (Takara, Kusatsu, Japan), were treated with ExoSAP-IT (USB Corporation, Cleveland, OH), and then labeled with the BigDye Terminator Cycle Sequencing Kit v3.1 (Life Technologies, Carlsbad, CA) using the same PCR primers as in the amplification reactions. Sequencing products were loaded on an ABI3500 capillary sequencer (Life Technologies). The following primers were used for sequencing: R122C_seq forward: 5’-TGATGGCCGGCAATGATGAGAACTACTCCG-3’, reverse: 5’-GCGGCCGCAGCACCGGAGACTTCAGAAGTTGCTAAACC-3’.
4
Agar-Based Detection and Lysis of S. stercoralis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The agar culture method for detection of S. stercoralis and worm lysate preparation procedures were based on previous publications [9 (link), 10 (link)]. Agar plates were cultured at room temperature (approximately 25 °C) for 4 days. Then, they were checked daily under a stereomicroscope to detect any nematode. Larvae or adult stages of nematodes found on the agar plates were picked up by a worm picker (fine needle made from tungsten) into polymerase chain reaction (PCR) tubes containing 10 μl of worm lysis solution that was prepared by mixing 0.5 volume of proteinase K (> 600 mAU/ml solution, catalog no. 19131, Qiagen), 0.5 volume of 1 M dithiothreitol (DTT), and 10 volumes of DirectPCR Lysis Reagent (Tail) (catalog no. 101-T, Viagen Biotech Inc.). The nematodes were lysed by incubation at 60 °C for 20 min. They were then incubated at 95 °C for 20 min to inactivate proteinase K. The tubes containing worm lysate were stored at − 30 °C until used.
Presence of STHs other than S. stercoralis was assessed by direct wet mount microscopy.
Presence of STHs other than S. stercoralis was assessed by direct wet mount microscopy.
5
Genotyping cPLA2α Deficient Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6J mice were obtained from The Jackson Laboratory. cPLA2α deficient mice [38 (link)] were backcrossed up to the tenth generation in C57BL6/J background. The reproduction of cPLA2α deficient mice was maintained by crossing heterozygous males and females, and the littermate cPLA2α wild type (WT) and cPLA2α KO were used for our experiments. The identification of cPLA2α genotypes was performed using DNA isolated from mouse tail. The tails were digested with DirectPCR Lysis Reagent (Tail) (Viagen Biotech) and Proteinase K (Invitrogen) according to the manufacturer protocol and PCR amplification was performed using HotStarTaq DNA Polymerase (Qiagen) and the following primers: cPLA2 α forward (5′-TTCTCTGGTGTGATGAAGGC-3′ ), cPLA2 α reverse 5′-AAACTGACTGTAGCATCACAC-3′ ), NeoForward (cPLA2α KO) (5′- ATCGCCTTCTTGACGAGTTC-3′ ). The following PCR steps were used: 15 minutes at 95°c, 35 cycles of 45 seconds at 94°c, 60 seconds at 65°c and 60 seconds at 72°c and the final step is 10 minutes at 72°c. The PCR products were then separated on 1.5% agarose gel containing ethidium bromide. The WT and KO products were distinguished by visualization of bands at 224 and 570 bp, respectively.
6
Genotyping Crym transgenic mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Crym tg mice were backcrossed with control C57BL/6J mice. Non-littermate F1 heterozygotes were then bred together to generate F2 mice. Tail snips of Crym tg, C57BL/6J, F1 heterozygotes, and F2 mice were taken at 6 weeks of age or older. Genomic DNA was extracted from the tail snips by following the manufacturers protocol from the PureLink Genomic DNA Mini Kit (K182001; Invitrogen) modified only by substituting DirectPCR Lysis Reagent (Tail) (102-T; Viagen Biotech, Los Angeles, CA) in place of PureLink Genomic Digestion Buffer. Crym tg, F1 heterozygotes, and C57BL/6J mice were genotyped using a multiplexed probe-based assay from IDT for Crym and Tert. The Crym assay was designed such that it would produce the same amplicon from the native Crym gene as well as the inserted transgene. A synthetic Crym amplicon was used as an interplate control and Tert was used as the control for copy number. RT-qPCR was used to determine copy number and average normalized Cq for each mouse. The amplification protocol followed the manufacturer's instructions (IDT). Mice were genotyped to one of the three genotypes when the calculated copy number and average normalized Cq was closest to a known genotype (i.e. Crym tg, C57BL/6J, or F1 heterozygotes).
7
DNA Extraction from FFPE Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA extraction was performed on rowi and kahu FFPE tissue scrolls using a commercial kit (NucleoSpin DNA FFPE XS, Macherey-Nagel, Germany) per the manufacturer's instructions, with the exception of the lysis step which was carried out in a 56 °C water bath overnight. For extraction of DNA from the T. axei positive control, a mix of 100 μl DirectPCR Lysis Reagent (Tail) (Viagen Biotech Inc., USA) and 2.5 μl Proteinase K solution (20 mg/ml, Ambion, CA, USA) was prepared and 10 μl of this solution added to a single nematode in a PCR tube. This was incubated in an Applied Biosystems GeneAmp PCR system 2400 thermocycler (Thermofisher, USA) for 16 h at 55 °C followed by 1 h at 90 °C.
8
Tail Biopsy Genotyping Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA for genotyping was isolated from tail biopsies. Tail biopsies (2 mm in length) were digested in 200 µL of Direct PCR Lysis Reagent (Tail) (Viagen Biotech Inc, Los Angeles, CA, USA) and 0.2 mg of proteinase K for 12–15 h at 55 °C followed by 1 h at 85 °C for proteinase K in activation. The DNA was directly used for PCRs. PCR products were separated by 2% agarose gel electrophoresis. Genotypes were determined according to the migration pattern. Primers are described in Supplementary Table S5 . Sequence analyses were carried out on ABI3500XL (Applied Biosystems). Sequences were analyzed using seqscape software (Applied Biosystems).
9
Genomic DNA Extraction and Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA for genotyping was isolated from tail biopsies. Tail biopsies (2 mm in length) were digested in 200 μl of DirectPCR Lysis Reagent (Tail) (Viagen Biotech Inc, CA, USA) and 0.2 mg of proteinase K for 12–15 h at 55°C followed by 1 h at 85°C for proteinase K inactivation. The DNA was directly used for PCRs. Multiplex PCR was done for 35 cycles, with an annealing temperature of 58°C, and an elongation time of 60 s at 72°C. PCR products were separated by 2% agarose gel electrophoresis. Genotypes were determined according to the migration pattern. Primers are described in Appendix Table S6 .
10
Genomic DNA Extraction and Junction PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from cultured cells was isolated with DirectPCR Lysis Reagent (Tail) (102-T, Viagen Biotech, Los Angeles, CA, USA). Cells in the 12-well plates were washed with DPBS and suspended in 70 μL of DirectPCR Lysis Reagent containing 0.2 mg/mL Proteinase K (25530049, Thermo Fisher Scientific, Waltham, MA, USA). The samples were incubated for 3–5 h at 55 ℃ until the cells were totally dissolved. To inactivate Proteinase K, crude lysates were incubated for 45 min at 85 ℃. For each junction PCR reaction, 5 μL of lysates and AccuPower PCR PreMix (K-2012, Bioneer, Seoul, Korea) were used. Primers used for the detection of HDR-mediated genomic integration had the following sequences: 5′-junction F: CGGAACTCTGCCCTCTAACG, 5′-junction R: TGAGGAAGAGTTCTTGCAGCT, 3′-junction F: CAGTGGCAGCCAGGTTAGC, 3′-junction R: CCTGGGATACCCCGAAGAGT.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!