RNA was isolated from the ventricles of a C57/B6 mouse (Charles River, Sulzfeld Germany) using the RNeasyFibrous Tissue Mini Kit (Qiagen, Hilden, Germany) following the manufacturer's instructions. RNA was transcribed into cDNA with the Superscript III kit (Invitrogen, Darmstadt, Germany). Two desmin coding sequences were amplified using phusion polymerase (Finnzymes, Vantaa, Finland) applying a two-step protocol (98 °C; 72 °C; 30 cycles) with the same forward (GGATCCACCGGTGCCACCATGAGCCAGGCCTACTCGTCC), but different reverse primers (TGAAGCGTACAAGAGGTGGCTGAGGGGTTCCCTGG and TGAAGCTGTACAGTGAGGACGGGGCCAGGACACTGAA) creating one clone with and one without an extended 3′UTR. Amplificons were subsequently cloned into the pCR blunt vector (zero blunt cloning kit; Invitrogen) creating pCR-Blunt-mDES-ext and pCR-Blunt-mDES, respectively. Plasmids from resulting colonies were harvested (QIAprep Spin Miniprep Kit; Qiagen) and sequenced (MWG, Ebersberg, Germany).
Zero blunt cloning kit
Manufactured by Thermo Fisher Scientific
Sourced in Germany
The Zero Blunt Cloning Kit is a molecular biology tool designed for efficient cloning of blunt-ended DNA fragments. It provides a reliable and simple method for inserting DNA sequences into a vector, enabling further analysis and manipulation. The kit includes all the necessary components, including the vector, competent cells, and buffers, to facilitate the cloning process.
Automatically generated - may contain errors
Lab products found in correlation
Phusion polymerase, by Thermo Fisher Scientific (1 mentions)
Superscript 3 kit, by Thermo Fisher Scientific (1 mentions)
Qiaprep spin miniprep kit, by Qiagen (1 mentions)
Rneasy fibrous tissue mini kit, by Qiagen (1 mentions)
Decalabel kit, by Thermo Fisher Scientific (1 mentions)
Rotihybrid quick buffer, by Carl Roth (1 mentions)
Digoxigenin rna labeling mix, by Roche (1 mentions)
Platinum pfx polymerase, by Thermo Fisher Scientific (1 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Qiaquick pcr purification kit, by Qiagen (1 mentions)
In fusion snap assembly master mix, by Takara Bio (1 mentions)
Pnl3.2 cmv, by Promega (1 mentions)
Pgl4.10 luc2, by Promega (1 mentions)
6 protocols using zero blunt cloning kit
1
Mouse Ventricular Desmin Isoform Cloning
2
Intronic JH4 Sequence Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The intronic JH4 sequence flanking rearranged VH gene segments was amplified by PCR from DNA of EYFP+ germinal center and MBC subsets from 900 up to 15,000 cells. PCR primers and reaction conditions were described previously (15 (link)). PCR products were cloned with the Zero Blunt cloning kit (Invitrogen) and sequences were determined with an ABI Prism 3130xl Genetic Analyzer. Mutations were determined within 461 bp of the JH4 intron through the help of the CodonCodeAligner software.
3
Screening and Sequencing of Phage Cosmid Library
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Phage plaques were transferred to charged nylon membranes (GE Healthcare, Little Chalfont, UK) and screened with 32P-labeled nucleic acid probes prepared using the DecaLabel kit (Thermo Fisher Scientific, Waltham, MA, USA). For pre-hybridization and hybridization, the membranes were incubated in RotiHybrid Quick buffer (Carl Roth, Karlsruhe, Germany) supplemented with 0.1 mg/mL salmon sperm DNA. The membranes were hybridized for 15 h at 65 °C and washed four times with RotiHybrid Quick buffer diluted in progressively larger volumes of water (1:2 dilution for 30 min, 1:5 dilution for 30 min, and 1:10 dilution for 2 × 10 min). The membranes were exposed to X-ray film at − 80 °C for 4 days. Isolated positive cosmids were sequenced by primer walking, and the inserts were amplified and subcloned for DNA sequencing using the Zero Blunt Cloning Kit (Invitrogen, Karlsruhe, Germany).
4
Generating in situ hybridization probes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids for making in situ hybridization (ISH) probes were generated for select microarray candidates. cDNA sequences were obtained from NCBI, and PCR primers for generating ∼500-bp riboprobe sequences were selected using Primer-BLAST. 3′ sequences of the gene were targeted if possible (Table 5 ). Template cDNA was synthesized from RNA purified from E14–E16 retina using Superscript III Reverse Transcriptase (Invitrogen), and gene product was generated with targeted oligos and Platinum Pfx polymerase (Invitrogen). PCR product was purified using QIAquick PCR Purification kit (Qiagen, Hilden, Germany), inserted into pCR-Blunt II-TOPO vector using Zero Blunt Cloning kit (Invitrogen), and transformed into TOP10 or DH5α cells. Purified plasmids were linearized using restriction enzyme with overnight incubation at 37°C. Riboprobes were synthesized using the Digoxigenin RNA labeling mix (Roche, Basel, Switzerland). The following probe plasmids were obtained from other laboratories: Math5 (L. Gan, University of Rochester), Sema3e (A. Kolodkin, Johns Hopkins University), and Tbx20 (G. Papaioannou, Columbia University).
5
Soil Sampling and B. pseudomallei Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To ensure sufficient quality of the subsamples, several criteria had to be fulfilled. First, no inhibition of the qPCR was detectable; the difference between the quantification cycle (Cq) value of the sample + 100 copies pCR2.1-IAC and pure pCR2.1-IAC was below a value of 2. Second, more than 106 16S rRNA genes per PCR were detectable. If one of the three 1-g subsamples per sample did not fulfil these criteria, another 1-g subsample was extracted. A sample was defined as PCR positive if at least one replicate of the three subsamples revealed a Cq value above the limit of detection. Furthermore, all 10 soil sample from a non-endemic region, namely Greifswald, Germany, proved to be negative by B. pseudomallei -specific qPCRs. PCR amplicons from selected samples and qPCR targets were cloned using the Zero blunt cloning kit (Thermo Fisher Scientific, Braunschweig, Germany), were introduced into E. coli DH5a according to the manufacturer's instructions, and were subsequently sequenced.
6
Luciferase Assay Protocol with Promoter Cloning
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The vectors for the luciferase assay, pGL4.10[luc2] and pNL3.2.CMV, were purchased from Promega. The latter was edited for each promoter assay. For Fig. 3D , the hg19 genome region of chr1:3593076–3594185 was cloned using the Zero Blunt Cloning Kit (Thermo Fisher Scientific) and inserted between the KpnI and XhoI sites of pNL3.2.CMV. For all remaining luciferase assays in this study, the minimal promoter (minP) was removed using the In-Fusion Snap Assembly Master Mix (TaKaRa), and the appropriate sequences (enumerated in Supplementary Table S3) were inserted between the KpnI and XhoI sites of pNL3.2.CMV. Ectopic gene expression in the luciferase study was induced by pME18S or pCAGGS containing the corresponding coding sequence. HEK293 or Jurkat cells were transfected with the indicated plasmids using TransIT (for HEK293) or the Neon transfection system (for Jurkat). After 24 hours of incubation, the transfected cells were subjected to luciferase assay.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!