Applied biosystem stepone real time pcr system

To investigate the expression pattern of the SmJAZs in different tissues (taproot, fibril, leaf, petiole, stem, seed and flower) as well as its expression at 0 h, 0.5 h, 1.0 h, 2.0 h and 4.0 h after 100 μM MeJA treatment, plant materials were collected accordingly and total RNA was isolated according to the method described before23 (link)24 . Reverse transcription (RT) reaction was carried out using the kit (TaKaRa, Japan) with 20 μL volume consisting of 4 μL 5×M-MLV buffer, 2 μL 50 μM primer AP, 1 μL 10×dNTPs, 0.5 μL 200 U/μL RNase M-MLV and 0.5 μL 40 U/μL RNase inhibitor at 42 °C for 1.5 h, then inactivated at 70 °C for 15 min24 . The qRT-PCR reaction was carried out using the Super Real PreMix kit (Tiangen, China) and performed on the Applied Biosystem StepOne Real Time PCR System (Applied Biosystems, USA) with an optional 48-well plate. The house-keeping gene (SmActinF: 5′- AGCACCGAGCAGCATGAAGATT-3′; SmActinR: 5′- AGCAAAGCAGCGAACGAAGAGT-3′) was performed as an internal control to estimate the expression level of the SmJAZs according to the relative quantitative analysis method (2^−∆∆CT). Amplifications were performed under the following condition: 10 min denature at 95 °C, then 40 cycles of 15 s denature at 95 °C, 30 s annealing at 60 °C and 30 s extensions at 72 °C24 33 (link).

Samples, drought treated for 0 h, 2 h, 4 h and 8 h, were frozen in liquid nitrogen, and total RNA was extracted using the Tiangen plant total RNA extraction kit. The qRT-PCR experiments were carried out using Thermo Fisher quantitative master mix on the Applied Biosystem Step One Real-Time PCR System (Applied Biosystems, Foster City, CA, USA), with SmActin as the internal control. The relative expression level of selected genes was calculated using the 2^–ΔΔCT method. The experiments were conducted three times.

3-day-old male flies at a specific time were sampled and grinded with Trizol Reagent (TIANGEN) according to the manufacturer’s protocol. These then went through treatment with chloroform for removing protein impurity, isopropyl alcohol for precipitating nucleic acid, 75% ethanol for washing, and Rnase-free water for dissolving the precipitate. The concentration of the nucleic acid mixture was measured, and genomic DNA was removed and the mRNA was reversed transcribed using PrimeScript RT Reagent Kit with gDNA Eraser (TaKaRa). The Quantitative real-time PCR assay was performed using an Applied Biosystem Step One Real Time PCR system (Applied Biosystem, Foster, CA, USA) and SuperReal PreMix Plus (SYBR Green) (TIANGEN). The primers for amplifying: dAkh: For (5′- ATGAATCCCAAGAGCGAAGT -3′) and Rev (5′- CTACTCGCGGTGCTTGCAGTCCAGA -3′); foxo: For (5′- TTCTACCCCATGATGGACGG -3′) and Rev (5′- GCATTCGCATTCTGTATAGCCT -3′); actin: For (5′- CAGAGCAAGCGTGGTA TCCT -3′) and Rev (5′- CTCATTGTAGAAGGTGTGGTGC -3′).