RNA was extracted using TRIzol reagents, and isolated RNA was transcribed into cDNA using TaKaRa Reverse Kit (TaKaRa, Dalian, China). Afterwards, real-time PCR was performed on StepOne Real-Time PCR System and calculated using the 2−∆∆Ct method. Sequences of the primers were provided in Table 1 .
Takara reverse kit
Manufactured by Takara Bio
Sourced in China
The Takara reverse kit is a laboratory tool designed for the reverse transcription of RNA into complementary DNA (cDNA). It facilitates the conversion of RNA molecules into their DNA counterparts, a crucial step in various molecular biology workflows.
Automatically generated - may contain errors
3 protocols using takara reverse kit
1
RNA Extraction and Real-Time PCR
2
RT-qPCR Protocol for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT‑qPCR was performed using a previously described method 15 (link). Total RNA from cells was extracted using fasten 2000 RNA extract kit following the manufacturer's protocol. Reverse transcription was performed with 2 μg RNA using Takara reverse kit (Takara Biotechnology Co., Ltd., Dalian, China). SYBR green reaction mix (Takara) was used to perform RT-PCR following the manufacturer's instructions. Primer sequences used are shown in Table S1 . 18S was used as an internal control.
3
Quantitative Analysis of XAGE-1b Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trizol reagent (Invitrogen, USA) was used to extract RNA and cDNA was synthesized according to the instructions for Takara reverse kit (TaKaRa, China). Primer sequences of XAGE-1b were obtained from PCR Primer 5.0 software. The speci c sequences of primers were as follows: XAGE-1b (upstream-primer: 5'AAACCAGCTTGCGTTGTTTCAG3'; downstream-primers:5'CGCA TGTTCACTGGGCGTCTT3'). The reaction system of reverse transcription was prepared following the instructions of Takara RT-PCR kit. Relative expression quantity between the experimental group and the control group was represented by folders = 2 -ΔΔCT . The experiment was repeated three times.
Cell proliferation assay CCK8 assay kit (C0038, Beyotime, China) was used to detect cell proliferation. 1×10 3 GC cells with 100 μl culture medium were seeded into 96-well plates. The proliferation assay was performed by adding 10 μl CCK8 reagent into wells for incubation 2 h and measured continuously for 7 days respectively. The absorbance (OD) value of each pore at 450 nm was measured. The experiment was repeated three times.
Cell proliferation assay CCK8 assay kit (C0038, Beyotime, China) was used to detect cell proliferation. 1×10 3 GC cells with 100 μl culture medium were seeded into 96-well plates. The proliferation assay was performed by adding 10 μl CCK8 reagent into wells for incubation 2 h and measured continuously for 7 days respectively. The absorbance (OD) value of each pore at 450 nm was measured. The experiment was repeated three times.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!