Quantitecttm sybr green master mix

Total RNA was extracted using RNeasy Micro Plus Kits or RNeasy Mini Kits (QIAGEN, Hilden, Germany) as per the manufacturer’s instructions. Conversion of RNA into first strand cDNA (generated from 0.5–1 μg of RNA) was performed by using Superscript III Reverse Transcriptase (Life Technologies; Thermo Fisher Scientific).
Quantification of mRNA levels was carried out using qPCR. Dsg2 gene expression levels were validated using primers designed to span mouse Dsg2 intron/exon border between exons 14 and 15 (F- 5′AACGAAGCCGTAAGGACAAG 3′ R- 5′ GCCGCTTTCTCTGTGAAGTA 3′) using Primer Blast (NIH, MD, USA), and purchased from GeneWorks (Hindmarsh, SA, AUS). qPCR amplification was performed using QuantitectTM SYBR Green master mix (QIAGEN) on a Rotor-Gene thermocycler (QIAGEN) with reaction parameters: 15 min at 95 °C, then cycling of 10 s at 95 °C, 20 s at 55 °C and 30 s at 72 °C; for 45 cycles followed by a melt phase. Data was obtained and analyzed using Rotor-Gene Analysis Software version 6 (QIAGEN). All samples were run in triplicate. Relative gene expression levels were calculated using the comparative quantitation method normalized to the housekeeping gene hypoxanthine-guanine phosphoribosyltransferase (Hprt1) expression (F-5′CCCAGCGTCGTGATTAGCG3′ R-5′GCACACAGAGGGCCACAATG3′).

RNA was extracted from cell pellets using the RNeasy Micro Plus kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. Reverse transcription was performed on 1μg of purified RNA using a Superscript III enzyme (Life Technologies) following manufacturer’s instructions. Primers for PCR and qPCR (Supplementary Table 1) were either sourced from the literature or designed using Primer Blast (NCBI), synthesised (GeneWorks, Hindmarsh, SA, Australia) and validated for species specificity with Primer Blast (NCBI). qPCR was performed using QuantiTectTM SYBR Green master mix (Qiagen) on a Rotor-Gene thermocycler (Corbett Research, NSW, Australia) with reaction parameters: 15 minutes at 95 °C, then cycling of 10 seconds at 95 °C, 20 seconds at 57–60 °C, 30 seconds at 72 °C; for 45 cycles followed by a melt phase. Relative gene expression levels were calculated using the comparative quantitation method available in the Rotor-Gene Software (Corbett Research) and normalised against housekeeper genes GAPDH, ACTB, and CYCA validated using the geNorm algorithm (M value < 1.5).