Hiseq sr cluster kit v4

Barcodes of a DEL sample (input or eluted after screening) were PCR amplified using 3 µL i5 index primer (10 µM stock in water), 3 µL i7 index primer (10 µM stock in water), 19 µL cleaned up elution samples, and 25 µL Invitrogen Platinum™ Hot Start PCR Master Mix (2×) (Invitrogen 13000012). The PCR method is as follows: 95 °C for 2 min; 22 cycles of 95 °C (15 s), 55 °C (15 s), 72 °C (30 s); 72 °C for 7 min; hold at 4 °C. The PCR products were cleaned up using the ChargeSwitch PCR Clean-Up Kit, pooled in equimolar amounts, and the 187 bp amplicon was gel purified using a 2% E-Gel™ EX Agarose Gels (ThermoFisher Scientific G401002) and QIAquick Gel Extraction Kit (Qiagen 28704). The DNA concentration was measured using the Qubit dsDNA BR assay kit and sequenced using a HiSeq SBS v4 50 cycle kit (Illumina FC-401-4002) and HiSeq SR Cluster Kit v4 (Illumina GD-401-4001) on a HiSeq 2500 instrument (Illumina) in a single 50-base read with custom primer CTTAGCTCCCAGCGACCTGCTTCAATGTCGGATAGTG and 8-base index read 32 using custom primer CTGATGGAGGTAGAAGCCGCAGTGAGCATGGT (Supplementary Fig. 18).

Total RNA from Th1, Th17, and Treg cells was extracted with the MasterPure Complete DNA and RNA Purification Kit (Epicentre, UK) according to the manufacture's instruction. A total of 100 ng RNA was sonicated into fragments of 300–400 base pairs using Bioruptor (Diagenode, Belgium). mRNA library was prepared using VAHTS mRNA-seq V3 Library Prep Kit for Illumina (Vazyme, Nanjing, China) following the manufacture's protocol and sequenced on the Illumina HiSeq2500 sequencer with HiSeq SR Cluster Kit V4 and HiSeq SBS Kit V4 50 cycle kit (Illumina). The initial processing was performed by CASAVA (v1.8.2). Sequencing reads were then subjected to quality control processed by FastQC (v0.11.5) and trimmed by Cutadapt (v1.9.1). Quality controlled reads were then analyzed using DEseq2.

RNA was extracted from retinal tissue samples of C57BL/6 mice with and without RIR injury using a MasterPure Complete DNA and RNA Purification Kit (MC85200, Epicentre, Madison, WI, USA) according to the manufacturer’s instructions.
Briefly, 100 ng of RNA was sonicated into 300- to 400-bp fragments using a Bioruptor (Diagenode, Belgium), and sequencing libraries were prepared using a VAHTS Total RNA-seq (H/M/R) Library Prep Kit for Illumina® (NR603–02, Vazyme, Nanjing, China) following the manufacturer’s protocol. The RNA libraries were sequenced on an Illumina HiSeq2500 sequencer using a HiSeq SR Cluster Kit V4 (GD-401-4001, Illumina, San Diego, CA, USA) and a HiSeq SBS Kit V4 50 cycle kit (FC-401-4002, Illumina, San Diego, CA, USA). Initial processing was performed with CASAVA (v1.8.2, Illumina, USA).
After quality control with FastQC (v0.11.5), we used Cutadapt (v1.9.1) to trim low-quality bases. Trimmed reads were then aligned with TopHat (v2.0.11) to the mouse genome mm9, and unique mapped reads were obtained though filtering of the NH tags of bam files. We used Cufflinks (v2.1.1) to calculate gene expression values (as FPKM values) with the RefSeq mm9 reference transcriptome. Then, we summarized each sample’s expression values to detect significant differences in gene transcript expression between groups.