Quantitative PCR was carried out as described previously [45 (link)]. The primer sequences (TaKaRa Bio Inc., China) are showen in Additional file 1 : Table S2. β actin was used as an endogenous control.
Primer sequences
Manufactured by Takara Bio
Sourced in China
Primer sequences are short DNA fragments that serve as starting points for DNA synthesis during polymerase chain reaction (PCR) and other DNA amplification techniques. They are designed to be complementary to specific regions of the target DNA sequence, enabling the selective amplification of desired genetic material.
Automatically generated - may contain errors
Lab products found in correlation
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Simple chip enzymatic chromatin ip kit, by Merck Group (1 mentions)
Mx3005p, by Takara Bio (1 mentions)
Primescript1 rt reagent kit, by Takara Bio (1 mentions)
Sybr1 premix ex taqtm 2, by Takara Bio (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Gotaq qpcr master mix, by Promega (1 mentions)
Eastep super total rna extraction kit, by Promega (1 mentions)
Ab6285, by Abcam (1 mentions)
Enhanced chemi luminescence (ecl), by Applygen (1 mentions)
5 protocols using primer sequences
1
Quantitative PCR for Gene Expression
2
Chromatin Immunoprecipitation of TFEB
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Podocytes treated with BSA or AGE–BSA were used for ChIP assays. The Simple ChIP Enzymatic Chromatin IP Kit (Millipore, Billerica, MA, USA) was used following the manufacturer's protocol. Anti‐TFEB antibody (supplementary material, Table S3) was used to pull down DNA–protein complexes, and goat IgG was used as a control. Purified DNA was quantified using quantitative PCR (qPCR); primer sequences (TaKaRa Biotechnology, Dalian, PR China) are listed in the supplementary material, Table S4.
3
Quantifying SDF1 and CXCR4 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For qRT-PCR analysis of SDF1 and CXCR4 mRNA expression, total RNA from FA7DOWN/PA7UP, FSHUS/PNCEV and original F/P cells as well as normal liver cells in vitro and in vivo were extracted using Trizol reagent (Invitrogen, USA). Reverse transcription of purified RNA was performed using the PrimeScript1 RT reagent kit (Takara, Japan). Quantification of gene transcripts was performed by qRT-PCR (Fluorescence real-time quantitative PCR meter MX3005P, USA) using SYBR1 Premix Ex TaqTM II (Takara, Japan), and the levels were normalized to GAPDH as the internal control. Primer sequences (Takara, Japan) for SDF1, CXCR4 and GAPDH are listed in Table 2 . MXP software was used to analyze the results. Differences in mRNA expression were calculated according to the△△Ct method and displayed as 2(—△△Ct).
Primer sequences for SDF1, CXCR4 and GAPDH
| Sequence | Forward primer (5′ → 3′) | Reverse (5′ → 3′) |
|---|---|---|
| Gene name | ||
| SDF1 | CCTGTGTGTCATGCCCTCTT | AGTCCAGCCTGCTATCCTCA |
| CXCR4 | GTCAACCTCTAGAGCAGCGT | CTATCGGGGTAAAGGCGGTC |
| GAPDH | AAATGGTGAAGGTCGGTGTGAAC | CAACAATCTCCACTTTGCCACTG |
4
Quantifying p62 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of the cells was extracted using Eastep® Super Total RNA Extraction Kit (Promega, Shanghai, China). Concentration and purity of total RNAs were determined by ultramicro spectrophotometer. Reverse transcription was performed according to RevertAid First Strand cDNA Synthesis Kit (Thermo, Shanghai, China). Real-time PCR amplification was performed using SYBR green method according to GoTaq® qPCR Master Mix (Promega, China), and the CT values of the target primers were measured. The relative expression level of the target genes was calculated using the relative quantitative method 2−ΔΔct and normalized to the β-actin level. Primer sequences (Takara Biomedical Technology, Beijing, China) were as follows: p62-F: AGCTGCTTGGCTGAGTGTTAC; p62-R: CAATTTCCTGAAGAATGTGGG; β-actin-F: CATCCGTAAAGACCTCTATGCCAAC; β-actin-R: ATGGAGCCACCGATCCACA.
5
MASTL Silencing Regulates Cell Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA and protein was extracted from MGC-803 cells of shMASTL and shCtrl group. All procedures of RNA extraction, reverse transcription and ampli cation were same as the procedures mentioned above.
The primer sequences (Takara Bio, Dalian, China) were provided in Table 1. Likewise, all procedures of protein isolation, gel electrophoresis, transferring to PVDF and immune blots were same as the procedures mentioned above too. The blots were incubated with the appropriate primary antibody against CDK6 (1:1000, #3136, CST, USA), BMP2 (1:500, ab6285, ABCAM, USA), SNAI2 (1:1000, #3879, CST, USA) and CDKN1A (1:500, #2947, CST, USA) at room temperature. After washed with 5% non-fat milk in TBST saline (20 mM Tris-HCl, pH 7.4, 137 mMNaCl, and 0. 1% Tween-20) at room temperature for 1h, the blots were incubated with the corresponding horseradish peroxidase (HRP)-conjugated secondary antibody for 1.5h. Bands were monitored using western blot chemiluminescence (ECL, Applygen, Beijing, China) detection reagents and scanned images were quanti ed using ImageJ software. In addition, in order to explore possible signal pathway involved in the effects induced by MASTL silencing, non-
The primer sequences (Takara Bio, Dalian, China) were provided in Table 1. Likewise, all procedures of protein isolation, gel electrophoresis, transferring to PVDF and immune blots were same as the procedures mentioned above too. The blots were incubated with the appropriate primary antibody against CDK6 (1:1000, #3136, CST, USA), BMP2 (1:500, ab6285, ABCAM, USA), SNAI2 (1:1000, #3879, CST, USA) and CDKN1A (1:500, #2947, CST, USA) at room temperature. After washed with 5% non-fat milk in TBST saline (20 mM Tris-HCl, pH 7.4, 137 mMNaCl, and 0. 1% Tween-20) at room temperature for 1h, the blots were incubated with the corresponding horseradish peroxidase (HRP)-conjugated secondary antibody for 1.5h. Bands were monitored using western blot chemiluminescence (ECL, Applygen, Beijing, China) detection reagents and scanned images were quanti ed using ImageJ software. In addition, in order to explore possible signal pathway involved in the effects induced by MASTL silencing, non-
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!