Quikchange 2 site directed mutagenesis kit

The pcDNA4-TO-strep-HA-GFP-Treacle construct for GFP-Treacle expression, the deletion mutants F1-F5 and the point mutant S171A/T173A/T203A/T210A (STTT) has been described^{21 (link)}. Mutant derivatives S1236A, S1227A/S1228A and S1227A/S1228A/S1236A of this construct were generated by site-directed mutagenensis using the QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies). Sequences of the mutagenesis primers were:
S1236A forward: GGAGAGACTGGGCTGGCGCCACATC
S1236A reverse: GATGTGGTGGCGCCAGCCCAGTCTCTCC
S1227A/S1228A forward: GAGACCGCAGCAGCAGAGGCCGCCGAGGATGATGTGGTG
S1227A/S1228A reverse: CACCACATCATCCTCGGCGGCCTCTGCTGCGGTCTC
pcDNA5/FRT/TO-NBS1-mNG were generated by PCR amplification of mNG from pmNeonGreen-C1 (Allele Biotechnology) and ligation into pcDNA5/FRT/TO-NBS1-WT, -R28A, -K160M and R28A/K160M, respectively⁵⁰ . Plasmids pIRES V5 I-Ppo1 and pIRES I V5 -Ppo1(H98A) for I-Ppo1 mRNA purification (gift from Brian McStay) were described¹⁶ . pIRESneo2-TOPBP1-WT, -K154A/K155A (BRCT1), -K704A (BRCT5), -K1317A (BRCT7) were described^{37 (link),51 (link),52 (link)}. The mutant derivative W1145R of this construct was generated by site-directed mutagenensis using the QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies). Sequences of the mutagenesis primers were:
W1145R forward: GCCTTCCCAAAATGAACAGATCATTCGGGATGACCCTAC
W1145R reverse: GTAGGGTCATCCCGAATGATCTGTTCATTTTGGGAAGGC.

As previously described, MxA wild-type cDNA was cloned into pcDNA3.1(+)neo (Invitrogen) (55 (link)). MxA(R640A) cDNA in the pcDNA3.1(+)neo plasmid was kindly provided by Georg Kochs (Freiburg, Germany). MxA mutant D250N was generated using the QuikChange II site-directed mutagenesis kit (Agilent). Primers were designed using PrimerX (http://www.bioinformatics.org/primerx/) with the QuikChange protocol.
MxB cDNA with or without an N-terminal FLAG peptide sequence or MxB cDNA with an N-terminal large T-antigen NLS peptide with or without a FLAG peptide were cloned into pcDNA3.1(+)neo (Invitrogen) using the NotI and XbaI restriction sites. Plasmids encoding FLAG-Mx1 or FLAG-Mx1(K49A) were previously described (37 (link)). The TMx1-encoding plasmid was described previously (4 (link)). Primers were designed using PrimerX with the QuikChange protocol.
gBlocks for untagged MxA-MxB chimera were synthesized by Integrated DNA Technologies (IDT) and cloned into the multiple-cloning site of pcDNA3.1(+)neo. T103A and T151A mutants were generated using the QuikChange II site-directed mutagenesis kit (Agilent). Primers were designed using PrimerX with the QuikChange protocol.

Δ5–14, Δ35–44, Δ65–74, Δ100–111, Δ100–111 Δ130–141, Δ130–141, and Δ1–30 Δ120–167 deletion mutants (fragment 31–119) were created by using molecular cloning techniques. Briefly, fragment 31–119 (Δ1–30 Δ120–167) was chemically synthesized (Cell Guidance Systems, Cambridge, UK) and swapped with the full-length inverted SINE B2 sequence in SINEUP-GFP (Δ5′–32 nt); Δ5–14, Δ35–44, Δ65–74, Δ100–111, Δ100–111 Δ130–141 and Δ130–141 deletion mutants were mutagenized by using QuikChange II site-directed mutagenesis kits (Agilent Technologies Inc., Santa Clara, CA, USA) in accordance with a protocol published previously (11 (link),30 ).

Mutagenesis reactions were performed with the Quikchange II site-directed mutagenesis kits (Agilent). Mutagenesis primers were designed using the Agilent on-line primer design tool.