First, pSANG-oR-o7D12-Dual plasmid was digested with BamHI (NEB). After digestion, the linearized plasmid was purified using the QIAquick PCR Purification Kit (QIAGEN). Next, the DNA fragment containing the genes for the MbPyl(Bpa)RS-A2/evMbPyltRNAUACU pair from pAS64-A2 (for pAS64-A2, see Construction of pSANG_7D12-32TAG_MbPyl(Bpa)_tRNACUA and pSANG_7D12-109TAG_MbPyl(Bpa)_tRNACUA plasmids) was PCR amplified using primers o-pSANG_AS61_BamHI_f and o-pSANG_AS61_BamHI_r (Supplementary Table 1 ) and Q5-DNA polymerase (NEB). This PCR product was cloned into pSANG-oR-o7D12-Dual plasmid previously digested with BamHI using the Gibson Assembly Cloning Kit (NEB) according to the manufacturer’s instructions. We named this plasmid as pSANG-oR-o7D12-Dual-Pyl(Bpa). The identity of pSANG-oR-o7D12-Dual-Pyl(Bpa) plasmid was confirmed by Sanger sequencing.
Bamhi
Manufactured by New England Biolabs
Sourced in United States, United Kingdom, China, Germany
BamHI is a restriction endonuclease enzyme that recognizes and cleaves the DNA sequence 5'-GGATCC-3'. It is commonly used in molecular biology applications for DNA manipulation and analysis.
Automatically generated - may contain errors
Lab products found in correlation
Ecori, by New England Biolabs (101 mentions)
Xhoi, by New England Biolabs (75 mentions)
Hindiii, by New England Biolabs (58 mentions)
T4 dna ligase, by New England Biolabs (47 mentions)
Xbai, by New England Biolabs (46 mentions)
T4 ligase, by New England Biolabs (17 mentions)
Qiaquick gel extraction kit, by Qiagen (12 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (12 mentions)
Ecorv, by New England Biolabs (11 mentions)
Qiaprep spin miniprep kit, by Qiagen (10 mentions)
T4 dna ligase, by Thermo Fisher Scientific (10 mentions)
Bglii, by New England Biolabs (8 mentions)
Qiaquick pcr purification kit, by Qiagen (7 mentions)
Proteinase k, by Thermo Fisher Scientific (7 mentions)
Haeiii, by New England Biolabs (6 mentions)
Clonexpress 2 one step cloning kit, by Vazyme (6 mentions)
Pcdna3, by Thermo Fisher Scientific (6 mentions)
Bca protein assay kit, by Thermo Fisher Scientific (6 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (6 mentions)
Dpni, by New England Biolabs (5 mentions)
481 protocols using bamhi
1
Generating Dual-Pyl(Bpa) Plasmid
2
Enzyme-Mediated DNA Dynamics Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA samples were ordered from Integrated DNA Technologies (Coralville, IA) and used without further purification. Detailed construct, information including sequences and dye labeling positions, can be found in Table S1 . Duplexes were formed by mixing the labeled and the complementary strands with a ratio of 1:1.5 in HN100 buffer (20 mM HEPES (pH 8.0) and 100 mM NaCl), heating to 90°C for 2 min, and gradually cooling to room temperature (over 30–60 min). Restriction enzymes (BamHI and EcoRI) were purchased from New England BioLabs (Ipswich, MA) (BamHI: R0136M, EcoRI: R0101M) and used without further purification. The stock concentrations of the enzymes (BamHI: 1.1 μM, EcoRI: 0.74 μM) were provided by New England BioLabs. ABEL trap experiments were performed in a buffer containing 20 mM HEPES (pH 7.8), 25 mM NaCl, 2 mM CaCl2 with 5–10 pM labeled DNA duplex, 1–10 nM BamHI, and/or 0.4–5 nM EcoRI. An oxygen scavenger system [50 or 100 nM protocatechuate 3,4-dioxygenase (OYC Americas, Vista, CA) and 2 mM protocatechuic acid (Sigma, St. Louis, MO)] and 2 mM Trolox were added to suppress Cy5 blinking and photobleaching (32 (link)). The final sample solution also contained ∼0.5 pM Atto647N-labeled single-stranded DNA (5′-Atto647N-AAC TTG ACC C), which served as a fiducial marker of diffusion coefficient measurement consistency across different experimental runs.
3
Single-Molecule DNA Restriction Enzyme Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA samples were ordered from Integrated DNA technology (IDT, Coralville, IA) and used without further purification. Detailed construct information including sequences and dye labeling positions can be found in Table S1. Duplexes were formed by mixing the labeled and the complimentary strands with a ratio of 1:1.5 in HN100 buffer (20 mM HEPES, pH8, 100 mM NaCl), heating to 90 ºC for 2 min and gradually cooling to room temperature. Restriction enzymes (BamHI and EcoRI) were purchased from New England BioLabs (BamHI: R0136M, EcoRI: R0101M) and used without further purification. The stock concentrations of the enzymes (BamHI:
1.1 μM, EcoRI: 0.74 μM) were provided by New England BioLabs. ABEL trap experiments were performed in a buffer containing 20 mM HEPES pH 7.8, 25 mM NaCl, 2 mM CaCl2 with 5-10 pM labeled DNA duplex, 1-10 nM BamHI and/or 0.4-5 nM EcoRI. An oxygen scavenger system [50 or 100 nM protocatechuate 3,4-dioxygenase (OYC Americas) and 2 mM protocatechuic acid (Sigma)] and 2 mM Trolox were added to suppress Cy5 blinking and photobleaching 29 . The final sample solution also contained ~0.5 pM Atto647N-labeled ssDNA (5'-Atto647N-AAC TTG ACC C) which served as a fiducial marker of diffusion coefficient measurement consistency across different experimental runs.
1.1 μM, EcoRI: 0.74 μM) were provided by New England BioLabs. ABEL trap experiments were performed in a buffer containing 20 mM HEPES pH 7.8, 25 mM NaCl, 2 mM CaCl2 with 5-10 pM labeled DNA duplex, 1-10 nM BamHI and/or 0.4-5 nM EcoRI. An oxygen scavenger system [50 or 100 nM protocatechuate 3,4-dioxygenase (OYC Americas) and 2 mM protocatechuic acid (Sigma)] and 2 mM Trolox were added to suppress Cy5 blinking and photobleaching 29 . The final sample solution also contained ~0.5 pM Atto647N-labeled ssDNA (5'-Atto647N-AAC TTG ACC C) which served as a fiducial marker of diffusion coefficient measurement consistency across different experimental runs.
4
Construction of pGBKT7-ApCE22 Bait Vector
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pGBKT7 vector was linearized by the BamHI (New England Biolabs, Ipswich, MA, USA) restriction endonuclease, and the effector ApCE22 primer with the complementary sequence of BamHI enzyme site of pGBKT7 was designed by Premier 5.0 software (Table S1 ). The bait gene ApCE22 was amplified by 2× TransTaq High Fidelity PCR SuperMix (TransGen Biotech, Beijing, China). The bait vector pGBKT7–ApCE22 was obtained by overnight treatment with homologous recombinant enzyme Exnase at 16 °C. It was transformed into E. coli DH5α via heat shock, followed by sequencing and detection. The positive colonies were selected for preservation, and the recombinant plasmid DNA of pGBKT7–ApCE22 was extracted and retained for subsequent use.
5
Cloning of reporter gene constructs
6
Generating Wheat Transgenic Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The coding sequence of TaCAMTA1b-B.1 was amplified from leaf cDNA using the specific primers TaCAMTA1b-B.1-F and TaCAMTA1b-B.1-R to generate overexpression lines. Following sequence verification, the full-length CDS was introduced to the expression vector pUBI-GFP using an adaptor containing KpnI (NEB, Beijing, China) and BamHI (NEB, Beijing, China) digestion sites. RNAi lines were generated by cloning a 184 bp fragment amplified from TaCAMTA1b-B.1 cDNA into the pCUB vector through BamHI restriction sites in the sense orientation and SacI (NEB, Beijing, China) restriction sites in the antisense orientation. The resulting plasmids were transformed into Agrobacterium strain EHA105 and subsequently introduced into the wheat cultivar Jingdong18 (J18). Agrobacterium-mediated transformation to obtain transgenic plants following the protocol described by Wang et al. [65 (link),66 (link)]. The primers used for vector construction are listed in Table S3 .
7
Cloning Luciferase Reporter Plasmid
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PBabe Neo plasmid (Addgene #1767) was linearized with the restriction enzyme BamHI (New England BioLabs). The Amplicin-resistance cassette in psiCHECK2- let-7 8X was digested with BamHI and BglII (New England Biolabs) and the 5000 bp fragment containing the luciferase reporters (but no AmpR) was ligated with the linearized Pbabe Neo. The resulting plasmid was ligated, selected with Ampicilin, and sequenced.
8
Amplification and Cloning of AcerOr1 and AcerOr2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pIB-AcerOr1/pIB-AcerOr2 plasmid constructs containing intact open reading frames, which were amplified with specific primers containing BamHI and EcoRI (NEB, Beverly, MA, USA) sites for the A. cerana cerana ORs AcerOr1 and AcerOr2 and cloned in the multiple cloning site of the pIB/V5-His vector (Invitrogen, Carlsbad, CA, USA), were used to generate the final transformation plasmids by restriction digestion with BamHI and EcoRI (NEB, Beverly, MA, USA). The specific primer sequences were as follows: AcerOr1 F: 5′-CGCGGATCC ATGGAAAATACCACGAATTATCGTA-3′, AcerOr1 R: 5′-CCGGAATTC TACCGTCATTGCACGCAGAA-3′, AcerOr2 F: 5′-CGCGGATCC ATGATGAAGTTCAAGCAACAGGG-3′, AcerOr2 R: 5′-CCGGAATTC CTTCAGTTGCACCAACACCA-3′.
9
Generation of GFP-tagged Tau Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate the GFP‐tau441 plasmid, human full‐length tau441 (2N4R) was cloned into the pMAXFP.Green (GFP) vector (Amaxa). GFP‐tau256 was generated by adding restriction sites for KpnI and BamHI (New England Biolabs) at the 5′ and 3′ end, respectively, of tau256, followed by ligation into the pMAXFP.Green vector after it was digested with KpnI and BamHI. tau256 itself was generated by placing a stop codon in tau441.
10
Cloning and Expression of Zebrafish flcn
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The full open reading frame for zebrafish flcn was cloned from total RNA extracted from pooled protruding-mouth stage AB* wild type embryos using TRIZOL reagent according to manufacturers’ instructions. Next, cDNA was produced using M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant (Promega M3681, M3682, M3683) and oligodT primers (Invitrogen). Zebrafish flcn cDNA was amplified using the following forward primer with BamHI restriction site: AATA GGATCC ATGAACGCTTTAGTTGCCCTG and reverse primer with Xba1 restriction site: AATA TCTAGA CCCGCTTTCAGTCTCTCTCAC and cloned into pCS2+ using BamHI (New England Biolabs) and XbaI (New England Biolabs). Plasmid was verified by sequence analysis.
Capped RNA was synthesised using 5 μg (5 μl) of NotI linearised flcn DNA using SP6 mMESSAGE mMACHINE kit (Ambion). The RNA was cleaned using GenElute™ Mammalian Total RNA Miniprep Kit (Sigma RTN70) as per manufacturer’s instructions Appendix 2.
Capped RNA was synthesised using 5 μg (5 μl) of NotI linearised flcn DNA using SP6 mMESSAGE mMACHINE kit (Ambion). The RNA was cleaned using GenElute™ Mammalian Total RNA Miniprep Kit (Sigma RTN70) as per manufacturer’s instructions Appendix 2.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!