Bglii

In order to construct the expression cassette, all the elements were synthesized by Generay Biotechnology Company (Shanghai, China) and sub-cloned into pGH cloning vector by NdeI and NheI restriction enzymes (Fermentas, Germany) (Figure 1). eGFP was sub-cloned into the cassette by Bglll and Notl (Figure 2). Briefly, 1 µg plasmid DNA was digested by BglII and NotI (Fermentas, Germany) and the relevant buffer was added up to the final volume of 20 µl in 37 °C for 1 h. Enzymatic reaction was inactivated by chloroform and the cloning procedure was confirmed by HindIII digestion.
Figure 1

Schematic view of expression cassette. Expression cassette contains CASQ2 enhancer, HRE, MLC2v promoter, IRES, and β-globin poly A sequence.

Figure 2

 Schematic view of eGFP cloning into the cassette. eGFP was cloned into the cassette by NotI and BglII restriction enzymes.

The expression vector pGEX-AgeI (modified pGEX-KG), and plasmids pCDNA-2, pCDNA-gs16 carrying a gs16 gene encoding the repetitive fragment of H-Chain (GS16, Figure 1A) [25 (link)], and pSL-fn (n = 1, 2, 3, 4, 8, and 12) [26 ] were constructed and stored at −80 °C in our laboratory, along with E. coli DH5α and the expression strain BL21 (DE3). The fn fragments are gene sequences encoding non-repetitive sequences of H-Chain and all multimers (F1, F4, and F8, Figure 1A). Restriction endonucleases BglII, HindIII, AgeI, and BamHI were purchased from Fermentas (vilnius, Lithuania), NgoMIV was purchased from Promega (Madison, WI, USA), and T4 DNA ligase, ScaI and DNA molecular weight standards were purchased from Takara (Kusatsu, Japan). Agarose for DNA electrophoresis was purchased from the Gene Company (Hong Kong, China).

The eukaryotic pcDNA3.1(+) vector (Clontech, Mountain View, CA, USA) carrying the constitutive cytomegalovirus (CMV) promoter was used as the transgene vector. The entire Nrn1 coding sequences with terminal NheI and XhoI restriction sites was cloned from rat RSC96 cell cDNA via PCR amplification using the primers Nrn1-NheI-F, 5'-CTA GCT AGC ATG GGA CTT AAG TTG AAC GGC-3' and Nrn1-Xho1-R, 5'-CCG CTC GAG TCA GAA GGA AAA GCC AGG TCG C-3' (the underlined letters indicate Nhe I and Xho I restriction enzyme sites, respectively). The PCR thermocycle conditions were as follows: 94° C for 5 min followed by 35 cycles of 94° C for 30 s, 58° C for 30 s, and 72° C for 30 s. The pcDNA3.1(+)-Nrn1 plasmid was constructed by inserting the Nrn1 coding sequences between the NheI and XhoI restriction sites of the pcDNA3.1(+) vector. The pcDNA3.1(+)-Nrn1 plasmid was then digested with BglII and StuI (Fermentas, MBI, USA), a linearized DNA fragment containing the CMV promoter and Nrn1 was recovered by removing macromolecular contaminants, and the purified 2.3-kb DNA fragment was used for pronuclear microinjection.

A transgenic cassette was created for dicot expression from a combination of the promoter sequence, cp4 EPSPS, and transcriptional termination sequences. A kanamycin selectable marker (neomycin phosphotransferase II, nptII) was used for maintenance in bacteria. The cauliflower mosaic virus promoter 35S [22 (link)] was used as a promoter in the cassette. Restriction digestion of the pCambia 1301 vector was performed using the restriction enzymes NCO1 and BglII. The restriction site was created in cp4 EPSPS by amplification with primers containing the sequence of restriction enzymes. The eluted product was ligated with the pCambia 1301 vector using the Fermentas ligation kit (Cat #EL0014). To confirm the cloning, the digestion procedure was performed using the restriction enzymes listed above. Digestion reactions were performed at 37 °C overnight in a PCR machine. Each 20-µl reaction contained 4–5 µg DNA, 2 µl 10 × recommended restriction buffer, and 5 U of NCO1 and BglII (Fermentas, USA). The DNA digestion was visually inspected under the UV light after agarose gel (1.5 %) electrophoresis. Orientation of the cp4 EPSPS gene was confirmed using the vector Forward primer GATTGATGTGATATCTCCACT and the gene Reverse primer ACTCTACCCATAGGTCTCTTAG and by sequencing with gene-specific primers.

Restriction enzymes HindIII, PstI, and BglII (Fermentas) were used for the digestion of V. cholerae O139 chromosomal DNA and immobilized on nylon membranes (Amersham International). The CT encoding gene (ctxA) probe was a 540-bp XbaI-ClaI (Fermentas) fragment cloned into the plasmid pKTN901 using EcoR1 linkers (Kaper et al., 1988 ). The 267-bp cep probe was derived from EcoR1 (Fermentas) digested pSC01 plasmid.

Each of the plasmids pTV-frg 1 and pTV-frg 2 was separately digested and linearized using BglII (Fermentas, Lithuania). The digestion reaction was performed on 500 ng of each plasmid with 2 units of BglII in an appropriate buffer condition. Incubation was performed at 37°C for 16 hours. Finally the products were examined on 1% agarose gel.