Gapdh

Manufactured by Bio-Rad

Sourced in United States, Germany, United Kingdom

GAPDH is a commonly used reference gene that encodes the enzyme glyceraldehyde-3-phosphate dehydrogenase, which is involved in the glycolytic pathway. GAPDH is often used as an internal control in gene expression studies due to its consistent expression across various cell types and experimental conditions.

Automatically generated - may contain errors

Lab products found in correlation

Image lab software, by Bio-Rad (20 mentions) Quantity one software, by Bio-Rad (20 mentions) Gapdh, by Cell Signaling Technology (17 mentions) Gapdh, by Abcam (13 mentions) Gapdh, by Proteintech (9 mentions) Ssoadvanced universal sybr green supermix, by Bio-Rad (9 mentions) Pvdf membrane, by Merck Group (9 mentions) P akt, by Cell Signaling Technology (8 mentions) β actin, by Bio-Rad (8 mentions) Gapdh, by Thermo Fisher Scientific (8 mentions) Gapdh, by Santa Cruz Biotechnology (7 mentions) Rneasy mini kit, by Qiagen (6 mentions) Ripa buffer, by Beyotime (6 mentions) Trizol reagent, by Thermo Fisher Scientific (6 mentions) Pierce bca protein assay kit, by Thermo Fisher Scientific (5 mentions) Bca protein assay kit, by Thermo Fisher Scientific (5 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (5 mentions) Quantity one 4, by Bio-Rad (5 mentions) P erk, by Cell Signaling Technology (4 mentions) Iscript cdna synthesis kit, by Bio-Rad (4 mentions)

Close spelling variants of this product

GAPDH (MCA4739; (3 citations) GAPDH primers (2 citations) PrimePCR Gapdh (2 citations) HFAB Rhodamine anti-GAPDH (5 citations) GAPDH antibody (2 citations) Anti-GAPDH (12 citations) GAPDH-HEX (3 citations) Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (2 citations) DdPCR CNV assay Gapdh (2 citations) FAM GAPDH assay (2 citations)

172 protocols using gapdh

Integrin Gene Expression Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

To explore integrin α2, αV and β1 gene expression, RNA from HepG2 and Huh7 was isolated using RNeasy Mini Kit (Qiagen, Hilden, Germany), according to [11 (link)].
The iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA) and gene specific primers (Integrin α2, αV, β1, GAPDH; Bio-Rad Laboratories) were employed: ITGA2 UniqueAssayID: qHsaCID0016134; ITGAV UniqueAssayID: qHsaCID0006233; ITGB1 UniqueAssayID: qHsaCED0005248; GAPDH UniqueAssayID: qHsaCED0038674. RNA levels were normalized with GAPDH and calculated in relative quantification as ∆∆Ct (elative fold change in gene expression).

Juratli M.A., Zhou H., Oppermann E., Bechstein W.O., Pascher A., Chun F.K., Juengel E., Rutz J, & Blaheta R.A. (2022). Integrin α2 and β1 Cross-Communication with mTOR/AKT and the CDK-Cyclin Axis in Hepatocellular Carcinoma Cells. Cancers, 14(10), 2430.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis of HCC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from HCC cells and tissues using RNeasy mini kit (Qiagen, Venlo, The Netherlands) according to manufacturer’s instructions. Two micrograms of RNA were retrotranscribed for cDNA synthesis using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, USA). Real-time qPCR was carried out in 20 µL final volume using 1 ng/µL cDNA and forward + reverse primers (500 nM each) using iTaq Universal SYBR Green Supermix (Bio-Rad, Laboratories (Hercules, CA, USA).List of sequences of used primers (5′–3′): GAPDH (For)—CACCATCTTCCAGGAGCGAG; GAPDH (Rev)—GACTCCACGACGTACTCAGC; E-Sel (For)—AGCTCTCACTTTGGTGCTTCT; E-Sel (Rev)—TAGCTTCCGTGGAGGTGTTG; ICAM-1 (For)—AGCTTCGTGTCCTGTATGGC; ICAM-1 (Rev)—TTTCTGGCCACGTCCAGTTT; VCAM-1 (For)—CGAACCCAAACAAAGGCAGAG; VCAM-1 (Rev)—CTCTGGGGGCAACATTGACA; GATA3 (For)—GGCAGGGAGTGTGTGAACTG; GATA3 (Rev)—GCCTTCGCTTGGGCTTAATG; T-bet (For)—GAGGTGTCGGGGAAACTGAG; T-bet (Rev)—ATGGGAACATCCGCCGTC; FoxP3 (For)—AACGGTGGATGCCCACG; FoxP3 (Rev)—GGCCACGTTGATCCCAGG; CD25 (For)—GCAGTGGCAACCTTGTCTCTATG; CD25 (Rev)—GGTTTTGCCCTTCCTCTTCAAC; TGFβ1 (For)—GGAAATTGAGGGCTTTCGCC; TGFβ1 (Rev)—GGTAGTGAACCCGTTGATGTCC.

Dituri F., Mancarella S., Serino G., Chaoul N., Lupo L.G., Villa E., Fabregat I, & Giannelli G. (2021). Direct and Indirect Effect of TGFβ on Treg Transendothelial Recruitment in HCC Tissue Microenvironment. International Journal of Molecular Sciences, 22(21), 11765.

+ Open protocol

+ Expand

Quantitative Analysis of Foxp3 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The reverse transcription kit and qPCR kit were purchased from Dalian Takara Company. The total RNA of spleen lymphocytes in each group was extracted by the TRIzol method. Total RNA concentration was determined by spectrophotometry. A cDNA template was obtained by using reverse transcription kit to extract 500 ng of total RNA from mouse lymphocytes. qPCR primers for target genes were designed and synthesized by Shanghai Sangon Co., Ltd.: Foxp3 Sense: 5′-CACCTATGCCACCCTTATCCG-3′, Foxp3 Anti-sense: 5′-CATGCGAGTAAACCAATGGTAGA-3′; GAPDH Sense: 5′-AGGTCGGTGAACGGATTTG-3′, GAPDH Anti-Sense: 5′-GGGGTCGTTGATGGCAACA-3′. Procedures were performed as described in SYBR Premix Ex Taq^TM II and tested by the U.S. Bio-Rad iQ5 qPCR system. Reaction conditions are as follows: 94°C, 30 s; 58°C, 30 s; and 72°C, 30 s, with a total of 40 cycles. As an internal reference gene, GAPDH was repeated for 3 times, and the mRNA expression of each group was calculated by the 2^-ΔΔCT method.

Gao J., Ying Y., Wang J, & Cui Y. (2020). Solanine Inhibits Immune Escape Mediated by Hepatoma Treg Cells via the TGFβ/Smad Signaling Pathway. BioMed Research International, 2020, 9749631.

+ Open protocol

+ Expand

Quantifying MyD88 Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with the Qiagen (Valencia, CA) RNeasy mini kit protocol. A total of 1 μg of RNA was converted to cDNA using iScript cDNA synthesis kit (Bio-rad). Real-time polymerase chain reaction (PCR) was performed using the model CFX96 (Bio-rad). Primers for MyD88 and GAPDH were purchased from Biorad: MyD88 (qHsaCED0046947), and GAPDH (qHsaCED0038674).

Mondello P., Derenzini E., Asgari Z., Philip J., Brea E.J., Seshan V., Hendrickson R.C., de Stanchina E., Scheinberg D.A, & Younes A. (2017). Dual inhibition of histone deacetylases and phosphoinositide 3-kinase enhances therapeutic activity against B cell lymphoma. Oncotarget, 8(8), 14017-14028.

+ Open protocol

+ Expand

Protein Expression Analysis via Immunoblotting

Check if the same lab product or an alternative is used in the 5 most similar protocols

Isolated protein samples were probed with antibodies against RIPK1 (#5389) (Pro-Sci, Poway, CA, USA), Cleaved Caspase-3 (Asp175) (Cell Signaling Technology, Massachusetts, USA), PCNA (clone PC10) (Dianova GmbH, Hamburg, Germany), and GAPDH (MCA4739; 1:5000; AbD SeroTec, Düsseldorf, Germany). As secondary antibodies, anti-rabbit-HRP (#7074; Cell Signaling) and anti-mouse-HRP (#sc-2005; Santa Cruz) were used.

Cubero F.J., Woitok M.M., Zoubek M.E., de Bruin A., Hatting M, & Trautwein C. (2019). Disruption of the FasL/Fas axis protects against inflammation-derived tumorigenesis in chronic liver disease. Cell Death & Disease, 10(2), 115.

+ Open protocol

+ Expand

Western Blot Analysis of Signaling Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were lysed in 1× Laemmli buffer supplemented with phosphatase inhibitors (Sigma-Aldrich) and 1× complete protease inhibitor cocktail (Roche; Indianapolis, IN), size fractionated on 12% acrylamide gels and subsequently electro-transferred onto Hybond enhanced chemiluminescent membranes (GE Healthcare; Waukesha, WI). Membranes were blocked in 5% milk in tris-buffered saline containing 1% tween 20 and probed with antibodies against phospho-jun proto-oncogene (pJUN; pc-Jun) (9164; Cell Signaling Technology; Danvers, MA), nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha (NFKBIA; IκBα) (sc-371; Santa Cruz Biotechnology; Dallas, TX), phospho-NFKBIA (9246; Cell Signaling Technology), phospho-AKT1 (9271S; Cell Signaling Technology), AKT (9272S; Cell Signaling Technology) and GAPDH (4699–9555(ST); AbD Serotec; Raleigh, NC). After washing, membranes were incubated with horseradish peroxidase-conjugated anti-rabbit (111–035–003; Jackson ImmunoResearch Laboratories Inc; West Grove, PA) or anti-mouse immunoglobulin (115–035–003; Jackson ImmunoResearch Laboratories Inc). Detection was by enhanced chemiluminescence (Pierce ECL Western Blotting Substrate; Thermo Fisher Scientific Inc.; Rockford, IL) and visualization by autoradiography.

Rider C.F., Shah S., Miller-Larsson A., Giembycz M.A, & Newton R. (2015). Cytokine-Induced Loss of Glucocorticoid Function: Effect of Kinase Inhibitors, Long-Acting β2-Adrenoceptor Agonist and Glucocorticoid Receptor Ligands. PLoS ONE, 10(1), e0116773.

+ Open protocol

+ Expand

Isolation and Analysis of Cardiac Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cytoplasmic and membrane protein were isolated from cultured NRVMs using PBS lysis buffer containing: 0.5% Triton X-100, 5 mM EDTA (pH 7.4), phosphatase inhibitors (10 mM NaF and 0.1 mM NaVO₄), proteinase inhibitors (10 μg/ml aprotinin, 10 μg/ml leupeptin, 1mM phenylmethylsulfonyl fluoride, 5 μg/ml pepstatin A, 8 μg/ml calpain inhibitor I & II, and 200 μg/ml benzamidine). Cardiac actin was isolated from resulting pellet using PBS lysis buffer containing 2% sodium dodecyl sulfate, SDS (Fisher Biotech), 1% IGEPAL CA-630 (Sigma), 0.5 % deoxycholate (Sigma), 5 mM EDTA (pH 7.4), and proteinase inhibitors. Protein abundance and phosphorylation levels in isolated protein were analyzed with Western blot analysis as described previously.^{27 (link)} Target antigens were probed with the following antibodies: Na⁺-Ca²⁺ exchanger protein (NCX) (Swant), phospholamban (PLBt) (Upstate Biotechnology), RyR (Research Diagnostics), α-sarcomeric actin and SERCA (Sigma), ANP (Abcam), GAPDH (AbD Serotec), LTCC-α1C subunit (Millipore), S2814-RyR, PS16-PLB, and PT17- PLB (Badrilla), Cleaved Caspase 3 and full length Caspase 3 (Cell Signaling). Rabbit- and mouse-HRP secondary antibodies (GE Healthcare) were used and Westerns were developed with Western Lightening ECL (Perkin Elmer).

Barr L.A., Makarewich C.A., Berretta R.M., Gao H., Troupes C.D., Woitek F., Recchia F., Kubo H., Force T, & Houser S.R. (2014). Imatinib Activates Pathological Hypertrophy by Altering Myocyte Calcium Regulation. Clinical and Translational Science, 7(5), 360-367.

+ Open protocol

+ Expand

Mouse Liver Proteomic Analysis via Immunoblotting and IP

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mouse livers were homogenized and subjects to immunoblotting and immunoprecipitation as described previously [21 (link)]. Whole-cell extracts from the livers and HeLa cells were homogenized and lysed in buffer containing 50 mM Tris-HCl (pH 7.5), 1% SDS, 5 mM EDTA, and 10 mM 2-ME, followed by sonication. The antibodies for α3, α6, β2, Rpt6, Rpn8, Rpn10 (N), Rpn10 (C), Rpn13, Uch37, mHR23B, Usp14, and polyubiquitin were described previously [21 (link), 59 (link)]. A polyclonal antibody that recognizes both ubiquilin-1 and ubiquilin-4 was raised by immunizing rabbits with recombinant full-length ubiquilin-4 proteins. For immunohistochemistry, monoclonal antibodies against Rpn13 were raised by immunizing rats with recombinant full-length Rpn13 proteins. The antibodies for Tubulin (sc-5286; Santa Cruz Biotechnology), Ki-67 (RM-9106; Thermo Scientific), Nrf1 (sc-13031; Santa Cruz Biotechnology), β-catenin (610153; BD biosciences), p62 (PM045; MBL), Actin (MAB1501R; Millipore), and GAPDH (MCA4739; AbD Serotec) were purchased. For immunoprecipitation, liver homogenates were immunoprecipitated with an anti-Rpt6 antibody as described previously [21 (link)]. Band intensities were quantified using Fusion software (M&S Instruments Inc.).

Hamazaki J., Hirayama S, & Murata S. (2015). Redundant Roles of Rpn10 and Rpn13 in Recognition of Ubiquitinated Proteins and Cellular Homeostasis. PLoS Genetics, 11(7), e1005401.

+ Open protocol

+ Expand

Liver Signaling Pathway Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Liver tissues were homogenized in ice-cold NP40-Buffer containing 50 mM Tri-HCl (pH 7.5), 150 mM NaCl, 0.5% NP40 and 50 mM NaF freshly supplemented with Complete Mini (Roche), PhosSTOP (Roche), 1 mM orthovanadate and 1 mM pefablock. Protein concentrations were determined by BIO-RAD protein assay (BIO-RAD Laboratories GmbH, Munich, Germany). Samples were separated by SDS-PAGE and transferred to a cellulose membrane and probed with antibodies for pAKT, pERK, pTyr705 STAT3, pSer727 STAT3, pSTAT5, pJNK and pSMAD2/3 (Cell Signaling, Danvers, MA, USA). As secondary antibodies, anti-rabbit-HRP (Cell Signaling) and antimouse-HRP (Santa Cruz, Heidelberg, Germany) were used. GAPDH from AbD SeroTec (Düsseldorf, Germany) was used as loading control. Analysis of intrahepatic IL-6 (Abcam, Cambridge, UK) and OSM (R&D Systems, Minneapolis, MN) was performed in duplicates (n=6) using a murine ELISA kit.

Hatting M., Spannbauer M., Peng J., Al Masaoudi M., Sellge G., Nevzorova Y.A., Gassler N., Liedtke C., Cubero F.J, & Trautwein C. (2015). Lack of gp130 expression in hepatocytes attenuates tumor progression in the DEN model. Cell Death & Disease, 6(3), e1667-.

+ Open protocol

+ Expand

Western Blot Antibody Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Western blots were performed as previously described.^{47 (link)} PARP (eBioscience, San Diego, CA, USA), tSTAT3 (Cell Signalling Technology Inc, Beverly, MA, USA), pERK (Santa Cruz Biotechnology, Santa Cruz, CA, USA), FLIP (NF-6) and Caspase 8 (Abexis Biochemical, Birmingham, UK) mouse monoclonal antibodies were used in conjunction with a horseradish peroxidase-conjugated sheep anti-mouse secondary antibody (Amersham, Chalfont St Giles, UK). FGFR4 XP, pAKT, tAKT, Caspase 9, Bcl-2, Bcl-xl, Bax, XIAP (Cell Signalling Technology Inc), FGFR4 C16, tERK, Mcl-1 (myeloid cell leukemia sequence 1; Santa Cruz Biotechnology) and pSTAT3 (Abcam, Cambridge, UK) were used in conjunction with anti-rabbit secondary antibody (Amersham). Equal loading was assessed using GAPDH (glyceraldehyde-3-phosphate dehydrogenase; AbD Serotec, Oxford, UK).

Turkington R.C., Longley D.B., Allen W.L., Stevenson L., McLaughlin K., Dunne P.D., Blayney J.K., Salto-Tellez M., Van Schaeybroeck S, & Johnston P.G. (2014). Fibroblast growth factor receptor 4 (FGFR4): a targetable regulator of drug resistance in colorectal cancer. Cell Death & Disease, 5(2), e1046-.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!