One step rt pcr kit

Total RNA was isolated from colon, liver and epididymal fat using Trizol according to the manufacturer’s instructions (Invitrogen). The mRNA expression level of IL-6, α-defensin, IL-22 and TNF-α was analyzed by using quantitative RT-PCR (qRT-PCR) according to the Biorad One-Step RT-PCR Kit in a CFX96 apparatus (Bio-Rad, Hercules, CA) with the following primers: TNF-α: CGAGTGACAAGCCTGTAGCC, CATGCCGTTGGCCAGGA; α-defensin: GGTGATCATCAGACCCCAGCATCAGT, AAGAGACTAAAACTGAGGAGCAGC; IL-6: GTGGCTAAGGACCAAGACC, GGTTTGCCGAGTAGACCTCA; IL-22: GTGCTCAACTTCACCCTGGA, TGGATGTTCTGGTCGTCACC; 36B4: TCCAGGCTTTGGGCATCA; CTTTATTCAGCTGCACATCACTCAGA. Relative expression in transcript levels were calculated by normalization of each amplicon to housekeeping gene 36B4.

For RNA isolation, cells were grown in CSE minimal medium containing 0.5 % (w/v) glucose (CSE-glucose) to an OD₆₀₀ of 0.5–0.8 and harvested. Preparation of total RNA was carried out as described previously (Ludwig et al., 2002 (link)). cDNAs were synthesized using the One-Step RT-PCR kit (Bio-Rad). qRT-PCR was carried out on an iCycler instrument (Bio-Rad) following the manufacturer’s recommended protocol by using the primers indicated in Table S1. The rpsE and rpsJ genes encoding constitutively expressed ribosomal proteins were used as internal controls. Data analysis and the calculation of expression ratios as fold changes were performed as described by Diethmaier et al. (2011) (link). qRT-PCR experiments were performed in duplicate.

U87/CD4/CXCR4 cells were infected with replication-competent HIV for 24 h with and without sudemycin D6. JLAT10.6 cells were treated with DMSO or TNF-α with or without sudemycin D6. Total cell RNA extraction was done with the RNeasy minikit (Qiagen) according to the manufacturer’s instructions. Real-time qRT-PCR was done with the Bio-Rad One-Step RT-PCR kit using the Bio-Rad CFX Connect system with SYBR green. All reaction mixtures included a negative control in which no reverse transcriptase was added. Gene expression was calculated by the comparative threshold cycle method (2^−ΔΔCT) using GAPDH as a control. Primers for the unspliced (US), singly spliced (SS), and multiply spliced (MS) HIV transcripts are shown in Text S1.

To verify the mutations in infected cell lines, DNA was isolated from 729B/HTLV-1, 729B/HTLV-1p12, and 729/HTLV-1ΔCTCF producer cell clones, as well as the immortalized PBMCs, and infected JET cells using the DNeasy Kit (Qiagen, Valencia, CA). Standard PCR followed by Sanger sequencing for vCTCF-BS mutation verification was performed for each newly generated producer cell clone and cocultured immortalized hPBMCs for 16 wks. The vCTCF-BS primer sets (S3 Table) and the following PCR conditions were utilized for PCR amplification: 95°C for 3 min followed by 35 cycles of 95°C for 15 sec, 60°C for 10 sec and 72°C for 1 min. Amplified PCR products for each sample were then gel purified using the Qiagen gel extraction kit (Qiagen, Valencia, CA) and submitted for Sanger sequencing.
Digital droplet PCR (ddPCR) was performed with DNA from infected cells, and the viral copy number was quantified using the primers and probes as indicated in S3 Table [73 (link)].
RT-qPCR was performed with RNA extracted with the RNeasy kit (Qiagen) and the spliced forms of tax or hbz mRNAs were measured using the one-step RT-PCR kit (BioRad, Hercules, CA). The plasmids encoding the cDNAs for HBZ or Tax were utilized as standards to determine the amount of each mRNA and the results were normalized to GAPDH mRNA [74 (link)].

Expression of the three Nrf2-dependent genes HMOX1, GCLM and SLC7A11 were quantified by quantitative reverse transcription-PCR (qRT-PCR) using standard techniques. Briefly, the same total RNA used for microarray assay was used for qRT-PCR using a One-Step RT-PCR kit (Bio-Rad Laboratories, Hercules, CA, USA) with SYBR green in a Bio-Rad CFX96 Real-Time PCR System (Bio-Rad Laboratories, Hercules, CA, USA) according to the manufacturer’s instructions. The delta-delta Ct method was used to calculate the relative fold gene expression in the samples. The following primers in Table 1 were designed and used for quantitative real-time PCR of the human genes shown.