Equal quantities of total RNA for both genes were reverse transcribed by the EasyScript Two-Step RT-PCR SuperMix. The RT-qPCR reaction system contained 10 µl of a 2×Ultra SYBR Mixture (with ROX) (CWBiotech, Beijing, China), 0.3 µl of each gene-specific primer (qCYP1 and qCYP2 or qTCPR3 and qTCPR4, Table 1 ) for a final concentration of 1 µM, 2 µl of cDNA template, and 7.4 µl of RNase-free water. The amplification was performed at 95°C for 10 min and followed by 40 cycles (95°C for 15 s and 62°C for 1 min). Each sample reaction was carried out in triplicate, and the dissociation curve analysis of the amplified products was performed at the end of each PCR reaction to confirm the specificity and unique of the PCR product. The cycle threshold (Ct) values of SeCYP9A11, SeCPR, and the β-actin were examined and the comparative Ct method was used to analyze the expression of SeCYP9A11 and SeCPR mRNA as described by Livak et al. (2001) (link). RT-qPCR data were analyzed with SDS 1.4 software (Applied Biosystems, CA).
Ultra sybr mixture with rox
Manufactured by CWBIO
Sourced in China, United States, Germany
Ultra SYBR Mixture with ROX is a ready-to-use solution for real-time PCR (qPCR) and RT-qPCR applications. It contains a proprietary blend of SYBR Green I dye and ROX reference dye, optimized for reliable and sensitive detection of target sequences.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Hifi mmlv cdna kit, by CWBIO (4 mentions)
Ultrapure rna extraction kit, by CWBIO (4 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (3 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (3 mentions)
Fastking gdna dispelling rt supermix kit, by Tiangen Biotech (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Super cdna first strand synthesis kit, by CWBIO (2 mentions)
Hifi mmlvcdna synthesis kit, by CWBIO (2 mentions)
Veriti 96 well thermal cycler, by Thermo Fisher Scientific (2 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Trizol agent, by Thermo Fisher Scientific (2 mentions)
All in one rt mastermix, by Abmgood (2 mentions)
Sds 1, by Thermo Fisher Scientific (1 mentions)
Real time thermal cycler, by Analytik Jena (1 mentions)
Easyscript one step gdna removal and cdna synthesis supermix, by Transgene (1 mentions)
7500 fast pcr system, by Thermo Fisher Scientific (1 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (1 mentions)
Protoscript first strand cdna synthesis kit, by New England Biolabs (1 mentions)
Rneasy kit, by Qiagen (1 mentions)
29 protocols using ultra sybr mixture with rox
1
RT-qPCR Analysis of CYP and CPR Gene Expression
2
Validating Differential Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Three replicates of qRT-PCR were performed for each sample to verify the DEGs detected by the transcriptome sequencing. We selected six genes for validation and analysis. We used Primer Premier 5.0 software (http://www.premierbiosoft.com/primerdesign/ ) to design primers (Table A1 ). Primers were synthesized in the Shanghai Shenggong Company. We synthesized cDNA according to the manufacturer's instructions using EasyScript One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China). QRT-PCR was performed in 15 μl reactions on the Real-Time Thermal Cycler (Analytik Jena AG, qTOWER3G, Germany). The template was 1.5 μl cDNA of the first strand. The rest were 7.5 μl of 2 × UltraSYBR Mixture (with ROX) (CWBIO, Beijing, China), 1.2 μl 10 μM forward primer, 1.2 μl 10 μM reverse primer, and 3.6 μl of ddH2O. The reference gene was GhUB7. The qRT-PCR program was set as follows: preincubation at 95°C, 10 min first; the second step was amplification at 95°C for 15 s, 60°C for 30 s, and 72°C for 30 s, 38 cycles in total. A melting curve analysis was performed in order to evaluate the primer's specificity. The melting curve analysis program was set as follows: 95°C for 15 s, 60°C for 60 s, 95°C for 15 s, and 60°C for 15 s.
3
Quantification of Pluripotency Markers in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted using the TRIzol Reagent (Invitrogen) and the quality was assessed with a nanodrop-1000 (Thermo Scientific) and Quantity One v4.6.3 system (Bio-Rad). RNA was then reverse-transcribed with the ProtoScript First Strand cDNA Synthesis Kit (E6300S; New England Biolabs). The levels of mRNA were determined using UltraSYBR Mixture (with ROX) (CW0956; CWBiotech). The levels of mRNA were normalized against the levels of GAPDH. The primers used were as follows: DNAAF1: forward 5′-TCGCACACCCAAGAGAAGAC3′, reverse 5′-GCGTATCATTCAATGCTGGGG-3′; Lefty1: forward 5′-ATACTGGGAGAGCTGGGGAT-3′, reverse 5′-GGGAACAATGGCAATTGGGG-3′; Lefty2: forward 5′-AGTGCTCTCGTCAGACCTTTG-3′, reverse 5′-TGGGGTCAGTGTGTCCTACT-3′; Nodal: forward 5′-GCCGACATCATTTGCCAGAC-3′, reverse 5′-CCCTCACAGCGATAGGCATT-3′; Gli1: forward 5′-CTGCGTGGTAGAGGGAACTC-3′, reverse 5′-GAAAGTCCTTCTGTTCCCATGC-3′; Gli2: forward 5′-ACTTTTGTCTCCTCGGGTCC-3′, reverse 5′-CTGCTGTCCTCCAAGAGACC-3′; Ptch1: forward 5′-GAAGCCACAGAAAACCCTGTC-3′, reverse 5′-GCCGCAAGCCTTCTCTAGG-3′; Gapdh: forward 5′-GTGGTGAAGCAGGCATCTGA-3′, reverse 5′-GCCATGTAGGCCATGAGGTC-3′. All PCR reactions were carried out using an Applied Biosystems 7500 fast PCR system.
4
Quantifying Embryonic Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from embryos with RNeasy kit (Qiagen, China) according to the manufacturers’ instructions. Reverse transcription reactions were performed using Super cDNA First-Strand Synthesis Kit (CWBiotech, China), and the quantification of total RNA was performed on a NanoDrop spectrophotometer. Real-time PCR was performed in an ABI 7500 real-time PCR system (Applied Biosystems, USA) using Ultra SYBR Mixture with ROX (CWBiotech, China). The following primers were used: C-kit (Forward: AAGGACTTGAGGTTTATTCCT, Reverse: CTGACGTTCATAATTGAAGTC); ETV5 (Forward: AGGACCCCAGGCTGTACTTT, Reverse: TGGCCGATTCTTCTGGATAC); GAPDH (Forward: AGAAGGCTGGGGCTCATTTG, Reverse: AGGGGCCATCCACAGTCTTC). The reactions were incubated at 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s and at 60 °C for 1 min. All reverse transcription reactions included no-template controls; and all PCR reactions were run in triplicate. Relative gene expression was determined using comparative CT (2-ΔΔCt) method. (human 3PN embryos: n = 50, mice 2PN embryos: n = 90).
5
Gene Expression Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the expression analysis, 1 µg RNA was used for reverse transcription. The cDNA was synthesized using a FastKing gDNA Dispelling RT SuperMix kit (TIANGEN) in accordance with the manufacturer’s instructions. qRT-PCR was performed using the UltraSYBR Mixture (with ROX; CWBio, Beijing, China) and the CFX96 real-time PCR detection system (Bio-Rad). The expression levels of detected genes were normalized to TUB2 expression. Error bars denote standard deviations of three biological replicates [18 (link)]. The primers used for the expression analysis are listed in Additional file 1 .
6
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For expression analysis, 1 μg RNA was used for reverse transcription. The cDNA was synthesized by using FastKing gDNA Dispelling RT SuperMix kit (TIANGEN, Beijing, China) according to the manufacturers' instructions. qRT-PCR was performed by using UltraSYBR Mixture (with ROX; CWBio, Beijing, China) and the CFX96 real-time PCR detection system (Bio-Rad). Expression levels of detected genes were normalized to TUB2 expression. Error bars denote SD of three biological replicates [18] . The primers used for expression analysis are listed in Additional le 1.
7
Klebsiella pneumoniae Transcriptional Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Klebsiella pneumoniae cells were harvested by centrifugation at 12,000 rpm and 4 °C and immediately chilled with liquid nitrogen to avoid RNA degradation. The cells were used for extracting total RNA. For CRISPRi strains Kp(ptac-puuC + placiL), Kp(ptac-puuC + placiD), Kp(ptac-puuC + placiA), Kp(ptac-puuC + placiM) and Kp(ptac-puuC + placiMALD), total RNA was extracted using the RNA prep pure Cell/Bacteria Kit (Tiangen, Beijing, China). The cDNA was synthesized using HiFi-MMLV cDNA Synthesis Kit (CWbio Co. Ltd). The chemically synthesized cDNA was mixed and subjected to gradient dilution and served as template to determine the specificity and efficiency of the primers. qRT-PCR was carried out using UltraSYBR mixture (with ROX) (CWbio. Co. Ltd). The cDNA from each sample was diluted to determine the linear range for qRT-PCR (Fig. 3 ). 16S rRNA was recruited as the internal standard in qRT-PCR analysis. The statistics was analyzed using 2−∆∆Ct strategy.
8
Plasma RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from plasma samples from 24 PD patients (Dnr_8 to Dnr_31) and 11 healthy controls (Dnr_35 to Dnr_45) using an exoRNeasy Serum/Plasma Maxi Kit (50) (Qiagen, Redwood City, CA, USA; cat. #77064). The DNA in the RNA residue was digested using a DNase I kit (CW Bio, Cambridge, MA, USA; cat. #CW2090). The RNA was reverse transcribed into complementary DNA (cDNA) using a HiFi‐MMLVcDNA kit (CW Bio; cat #CW0744) according to the manufacturer's instructions. PCR was performed on the cDNA using UltraSYBR Mixture (With ROX; CW Bio; cat #CW0956). No electrophoresis was performed because of a low RNA yield. β‐actin was used as a housekeeping gene. Data were calculated as relative expressions according to the ΔΔC(t) principle.18 , 19 The primer sequences were 5′‐GCA AGC CTA ACT CAA GCC ATT‐3′ and 5′‐TCA AGC CGA CTC TCC ATA CC‐3′ for GAS5:46; and 5′‐AGG TGG GAG GAT CGC TTG A‐3′ and 5′‐ACC ATA TTG ATG CCG AAC TTA GTG‐3′ for lnc‐MKRN2‐42:1.
9
Quantitative Real-Time PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from leaves using a Plant RNA Kit (Omega Bio-tek, United States) as the manufacturer’s instructions. First-strand cDNA was synthesized using the ReverTra Ace qPCR RT Master Mix with the gDNA Remover kit (TOYOBO, Japan). Quantitative real-time PCR (qRT-PCR) was performed on a qTOWER3G Touch thermal cycler (Analytik Jena, Germany) with Ultra SYBR Mixture (with ROX) (CWBIO, China) as described in the manufacturer’s instructions. The PCR program was performed as described previously (Yang et al., 2019 (link); Liu et al., 2020 (link)). The StEF1 (LOC102600107) was used as an internal control to normalize the results. Real-time PCR (RT-qPCR) data were transformed into log2-delta CT for one-way ANOVA followed by Tukey’s test analysis (P < 0.05). All qRT-PCR experiments were repeated at least twice in triplicate. The primers used in qRT-PCR are listed in Supplementary Table 2 .
10
Quantifying KGF Expression in Lung Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA in lung samples was extracted with the ultrapure RNA extraction kit (Cat# CW0581, CWbio Co., Ltd.) and was reverse-transcribed into cDNA using a HiFi-MMLV cDNA kit (Cat#CW0744, CWbio Co., Ltd.). The RNA expression levels were detected by Ultra SYBR Mixture (with ROX) (Cat#CW0956, CWbio Co., Ltd.) according to the manufacturer's instruction. PCRs were performed in Line Gene type 9600 Plus Real-Time PCR system (Bioer Technology Co. Ltd., Hangzhou, China). The primer sequences were as follows: β-actin (FW 5′-GCCTTCCTTCTTGGGTAT-3′ and RV 5′-GGCATAGAGGTCTTTACGG-3′) and KGF (FW 5′-TGCTTCCACCTCGTCTGTC-3′ and RV 5′-TCCTTCCATGTAGTCATAACTTCTG-3′). The amplification program was 95°C for 10 min followed by 45 cycles of 95°C for 15 s and 60°C for 60 s. The quantity of specific mRNA was normalized to the expression level of internal control β-actin mRNA. Gene expression was calculated using the 2ΔΔCt method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!