Log In Sign up
The largest database of trusted experimental protocols

Pgipz

Manufactured by Horizon Discovery
Visit Supplier
Sourced in United States, United Kingdom

The PGIPZ is a laboratory product designed for DNA editing applications. It functions as a plasmid-based system for the expression of CRISPR-Cas9 components. The core function of PGIPZ is to enable targeted genetic modifications in a variety of cell types.

Automatically generated - may contain errors

Lab products found in correlation

Puromycin, by Merck Group (5 mentions) Virapower kit, by Thermo Fisher Scientific (2 mentions) Plko 1, by Horizon Discovery (2 mentions) Q5 site directed mutagenesis kit, by New England Biolabs (2 mentions) Ptripz, by Horizon Discovery (2 mentions) Pgipz shrna clones, by Thermo Fisher Scientific (2 mentions) Lmp vector, by Thermo Fisher Scientific (2 mentions) β actin, by Santa Cruz Biotechnology (2 mentions) Peg it virus precipitation solution, by System Biosciences (2 mentions) Polybrene, by Merck Group (2 mentions) Turbofect, by Thermo Fisher Scientific (2 mentions) Lipofectamine 2000 transfection reagent, by Thermo Fisher Scientific (2 mentions) Opti mem, by Thermo Fisher Scientific (2 mentions) Fugene 6 reagent, by Promega (1 mentions) Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions) Pegfp c3, by Takara Bio (1 mentions) Pegfp n1, by Takara Bio (1 mentions) Hiv p24 elisa, by Cell Biolabs (1 mentions) Plk0.1 puro, by Merck Group (1 mentions) Puromycin ant pr, by InvivoGen (1 mentions)

23 protocols using pgipz

1

Lentiviral shRNA-mediated ACLY knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
A non-silencing lentiviral shRNA (pGIPZ) was used as a control and three different ACLY shRNA lentiviral constructs (pGIPZ) were obtained from Horizon Discovery (Waterbeach, Cambridge, United Kingdom). Recombinant lentiviral particles were produced by transient transfection of 293T cells according to the manufacturer’s protocol. The PT-derived Pkd1−/−(PN24) and Pkd1+/− (PH2) cells were infected with the cell culture supernatant containing lentiviral particles for 48 h. These cells were then selected in puromycin to generate stable cell lines with non-silencing and ACLY-specific shRNA. Cell lines were validated for diminished ACLY expression by Western blot analysis.
Hallows K.R., Li H., Saitta B., Sepehr S., Huang P., Pham J., Wang J., Mancino V., Chung E.J., Pinkosky S.L, & Pastor-Soler N.M. (2022). Beneficial effects of bempedoic acid treatment in polycystic kidney disease cells and mice. Frontiers in Molecular Biosciences, 9, 1001941.
+ Open protocol
+ Expand
2

NEDD9 depletion by lentiviral shRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
NEDD9 was depleted by lentiviral transduction of short hairpin RNA constructs targeting human (pGIPZ, GE Dharmacon; Lafayette, CO, USA) or murine (pLKO.1, GE Dharmacon) NEDD9 (shRNA sequences in Supplementary Table S8). Lentivirus was generated using HEK293T cells and Virapower Kit (Invitrogen, now Thermo Fisher Scientific; Waltham, MA, USA) and filtered medium used to infect target cells. Transduced cells were selected with puromycin. Empty vector was used as negative control and shRNAs targeting GAPDH and eGFP were used as non-specific controls for human and mouse lines respectively.
Gabbasov R., Xiao F., Howe C.G., Bickel L.E., O’Brien S.W., Benrubi D., Do T.V., Zhou Y., Nicolas E., Cai K.Q., Litwin S., Seo S., Golemis E.A, & Connolly D.C. (2018). NEDD9 promotes oncogenic signaling, a stem/mesenchymal gene signature, and aggressive ovarian cancer growth in mice. Oncogene, 37(35), 4854-4870.
+ Open protocol
+ Expand
3

Engineered Caspase-4 Constructs in IMR90 Cells

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Using standard retro-transcription procedures, total RNA extracted from IMR90 cells was converted into cDNA generating a human coding sequence (CDS) library. CASP1 and CASP4 CDS were amplified from the obtained library and cloned into the pMSCV-puro vectors. The caspase-4 catalytically dead C258A pMSCV-puro vector was generated from the wild-type pMSCV-puro-CASP4 through site-directed mutagenesis by PCR using the Q5 Site-Directed Mutagenesis Kit (E0554S, New England Biolabs). The CASP4 and GSDMD-targeting lentiviral vectors (pGIPZ) were purchased from Dharmacon. The CASP4-targeting retroviral vectors (pRS-shCASP4-1 and pRS-shCASP4-2) were generated inserting the oligonucleotides (+) GATCCCCCAACGTATGGCAGGACAAATTCAAGAGATTTGTCCTGCCATACGTTGTTTTTG and GATCCCCTAACATAGACCAAATATCCTTCAAGAGAGGATATTTGGTCTATGTTATTTTTG, respectively, into the pRS empty backgone following the pSuper RNAi System manual (OligoEngine) instructions. pLN-ER:RAS, LSXN-ER:Stop, MSCV-RasG12V, pCMV-VSVG, and pUMVC3-gag-pol vectors have been described elsewhere [5 (link)].
Fernández-Duran I., Quintanilla A., Tarrats N., Birch J., Hari P., Millar F.R., Lagnado A.B., Smer-Barreto V., Muir M., Brunton V.G., Passos J.F, & Acosta J.C. (2021). Cytoplasmic innate immune sensing by the caspase-4 non-canonical inflammasome promotes cellular senescence. Cell Death and Differentiation, 29(6), 1267-1282.
+ Open protocol
+ Expand
4

Characterization of MCF10A, MCFDCIS, and HEK293 Cell Lines

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
MCF10A and MCFDCIS cell lines were obtained from Dr. Susette Mueller (Georgetown University) and were cultured as previously described (22 ,23 (link)). HEK293 cells were obtained from Dr. Rabindra Roy (Georgetown University) and were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (GIBCO/ Invitrogen, Carlsbad, CA, USA) with 10% fetal bovine serum. All cell lines were fingerprinted to confirm identity and Mycoplasma tested regularly (most recent test 6/2018). Cells were used between passages 4 and 15. The FOXM1-12D phosphor-mimic plasmid was obtained from Dr. Peter Sicinski (Dana Farber) (24 (link)) and was used to transfect HEK293 cells alongside an empty-vector control using the Fugene 6 reagent as recommended by the manufacturer (Promega, Fitchburg, Wisconsin, USA). 48 hours after transfection, G418 selection agent was added to cells at 800ug/mL and maintained for 14 days generate stable HEK-12D and HEK-EV cell lines. shMUC16 MCFDCIS lines were established using unique shRNA and non-silencing control sequences inserted into the pGIPz (Dharmacon) as previously described (25 (link)).
Kietzman W.B., Graham G.T., Ory V., Sharif G., Kushner M.H., Gallanis G.T., Kallakury B., Wellstein A, & Riegel A.T. (2019). Short and long-term effects of CDK4/6 inhibition on early stage breast cancer. Molecular cancer therapeutics, 18(12), 2220-2232.
+ Open protocol
+ Expand
5

Lentiviral shRNA Screening in Mouse Embryonic Fibroblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols
MEFs were infected with pools of lentiviral shRNAs in pGIPZ from (Dharmacon) archived by UMMS RNAi Core. Lentiviral pools of shRNAs (>1 x 106 pfu/ml per shRNA target) targeting the open reading frame of mouse DKK3 and Dkk3b transcripts (exons 4 and 8) (V3LMM_518668, V3LMM_487209, V3LMM_487206, V3LMM_487207), mouse ß-catenin (exons 5 and 8) (V2LMM_16708, V3LMM_491202, V2LMM_4912040), and human ß-TrCP (V2LHS_33325, V2LHS_33330, V2LHS_33325) and a non-silencing control (RHS4348) were used. Cells were infected with lentiviral pools of shRNAs (>1 x 106 pfu/ml per shRNA target), grown for 2 days and selected with puromycin. GFP positive shRNA expressing cells were used in all experiments.
Leonard J.L., Leonard D.M., Wolfe S.A., Liu J., Rivera J., Yang M., Leonard R.T., Johnson J.P., Kumar P., Liebmann K.L., Tutto A.A., Mou Z, & Simin K.J. (2017). The Dkk3 gene encodes a vital intracellular regulator of cell proliferation. PLoS ONE, 12(7), e0181724.
+ Open protocol
+ Expand
6

Generating Plasmids for AAG Knockdown Studies

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasmid pEGFP-hAAG was generated by cloning the XhoI-flanked AAG cDNA from pCAGGS-hAAG (36 (link)), into pEGFP-C3 or into pEGFP-N1 (Clontech, Takara BioUSA, Inc). Plasmid pCAGGS with the mAag-Y147I/H156L double mutant cDNA was generated by site-directed mutagenesis of the wild-type cDNA, as previously described (36 (link)). Knockdown resistant wild-type and Y127I/H136L double mutant human AAG cDNAs were generated by site-directed mutagenesis, using the Q5 Site-Directed Mutagenesis kit (E0554S; New England BioLabs). Primers used to mutagenize the human AAG cDNA are listed in SI Appendix, Table S1. The nucleotide sequence of all plasmids was confirmed by DNA sequencing. Lentiviral shRNA plasmids based on pGIPZ were purchased from Dharmacon; insert sequences are listed in SI Appendix, Table S2.
Milano L., Charlier C.F., Andreguetti R., Cox T., Healing E., Thomé M.P., Elliott R.M., Samson L.D., Masson J.Y., Lenz G., Henriques J.A., Nohturfft A, & Meira L.B. (2022). A DNA repair-independent role for alkyladenine DNA glycosylase in alkylation-induced unfolded protein response. Proceedings of the National Academy of Sciences of the United States of America, 119(9), e2111404119.
+ Open protocol
+ Expand
7

Lentiviral Knockdown and Overexpression in 293T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The lentivirus backbone vector pLK0.1-puro, engineered to express Hdac3 (TRCN0000039389), Gata6 shRNA (short hairpin RNA) (TRCN000085589) or non-silencing shRNA control was purchased from Sigma-Aldrich and GE Dharmacon (Lafayette, CO). The lentivirus backbone vector PGIPZ expressing p300 shRNA (V2LMN_102133 and V2LMN_90586) or non-silencing control shRNA was obtained from GE Dharmacon. Mouse Gata6 cDNA was cloned into the lentivirus backbone vector pRRL.hCMV.Sin.IRES.GFP63 (link). Infectious lentivirus was created by co-transfection of lentivirus vectors expressing Hdac3, Gata6 and p300 shRNAs and Gata6 or control vectors with pCMVΔR8.91 and pMD.G into human 293 T cells. The infection mixture was added dropwise to 293 T cells plated on 100-mm culture dishes and incubated at 37 °C overnight. Virus was harvested 48 h or 72 h after transfection, concentrated with PEG-it virus precipitation solution (System Biosciences, Mountain View, CA) and titered with HIV p24 ELISA (Cell Biolabs, San Diego, CA).
Flodby P., Li C., Liu Y., Wang H., Rieger M.E., Minoo P., Crandall E.D., Ann D.K., Borok Z, & Zhou B. (2017). Cell-specific expression of aquaporin-5 (Aqp5) in alveolar epithelium is directed by GATA6/Sp1 via histone acetylation. Scientific Reports, 7, 3473.
+ Open protocol
+ Expand
8

Generating Stable shRNA Knockdown Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Dharmacon pGIPZ lentiviral vectors containing shRNAs targeting UBE2S (5′-acaaatccaggtcccagtg-3′), or APC4 (ANAPC4-A, 5′-tatctctggagctaaagcg-3′; ANAPC4-B, 5′-tatgagtaaactttctggc-3′; ANAPC4-C, 5′-agtccatctcctatgtcct-3′; ANAPC4-D, 5′-aactgattcatcaagagag-3’; ANAPC4-E, 5′-tacaatggaatacagattg-3′; ANAPC4-F, 5′-tttcctgcacaaacttggt-3′) were purchased (Horizon). Stable shRNA-mediated knockdown cell lines were generated by lentivirus-mediated transduction. Positive selection of transduced cells was performed 2 days after transfection with 1 µg/mL puromycin. Knockdown efficiency was assessed by immunoblotting.
Gliech C.R., Yeow Z.Y., Tapias-Gomez D., Yang Y., Huang Z., Tijhuis A.E., Spierings D.C., Foijer F., Chung G., Tamayo N., Bahrami-Nejad Z., Collins P., Nguyen T.T., Plata Stapper A., Hughes P.E., Payton M, & Holland A.J. (2024). Weakened APC/C activity at mitotic exit drives cancer vulnerability to KIF18A inhibition. The EMBO Journal, 43(5), 666-694.
+ Open protocol
+ Expand
9

Stable Lentiviral shRNA Screening

Check if the same lab product or an alternative is used in the 5 most similar protocols
All shRNA experiments were carried out by stable lentiviral transduction. Lentiviruses were generated by transfection of HEK293T cells with pInducer10 (Trono Laboratory, N/A, Lausanne, Switzerland) or pGIPZ (Dharmacon, N/A, Schwerte, Germany) together with the packaging plasmids psPAX.2 (Trono Laboratory, Addgene 12 260) and pMD.2G (Trono Laboratory, Addgene 12259). shRNA sequences are listed in Table S1. shRNAs against Miz1 were selected as described by Fellmann. Infections were carried out using 8 μg·mL−1 polybrene (107 689, Sigma). Forty‐eight hours after infection, cells were selected with 2 μg·mL−1 puromycin (ant‐pr, Invivogen, Toulouse, France), and pools of selected cells were used for downstream analyses.
Otto C., Kastner C., Schmidt S., Uttinger K., Baluapuri A., Denk S., Rosenfeldt M.T., Rosenwald A., Roehrig F., Ade C.P., Schuelein‐Voelk C., Diefenbacher M.E., Germer C., Wolf E., Eilers M, & Wiegering A. (2022). RNA polymerase I inhibition induces terminal differentiation, growth arrest, and vulnerability to senolytics in colorectal cancer cells. Molecular Oncology, 16(15), 2788-2809.
+ Open protocol
+ Expand
10

Lentiviral Knockdown of CHD7 in 293T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
293T cells were plated 24 hours before transfection at 80% confluency. Using Fugene HD, cells were transfected using pGIPZ (Dharmacon) lentiviral vectors encoding CHD7 shRNA along with PAX2 (Addgene #12260) and VSVG (Addgene #8454) vectors in penicillin/streptomycin free media. 24 hours after transfection, media was replaced with fresh media containing antibiotics. Virus was harvested 72 hours after transfection, filtered with .45 micron syringe filters, and titered. To infect, viral media was added to cells that had been plated 24 hours earlier, and replaced with fresh media 24 hours after adding viral media. Cells were grown for 72 hours after infection before adding puromycin for selection.
Boyd N.H., Walker K., Ayokanmbi A., Gordon E.R., Whetsel J., Smith C.M., Sanchez R.G., Lubin F., Chakraborty A., Tran A.N., Herting C., Hambardzumyan D., Gillespie G.Y., Hackney J.R., Cooper S.J., Jiao K, & Hjelmeland A.B. (2019). CHD7 is Suppressed in the Perinecrotic/Ischemic Microenvironment and is a Novel Regulator of Glioblastoma Angiogenesis. Stem cells (Dayton, Ohio), 37(4), 453-462.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!