Qiasymphony dsp virus pathogen kit

Viral RNA was extracted from respiratory samples either with the QiaSymphony DSP Virus/Pathogen Kit (Qiagen, Hilden Germany), the Maxwell RSC 48 RNA kit (Promega, Madison, United States (US)) or the EZ1 Virus Mini Kit (Qiagen). For diagnostic testing, the following PCR assays were used: The protocol from the US Centers for Disease Control and Prevention, the Charité protocol, the Seegene Allplex 2019-nCoV Assay or the Cobas SARS-CoV-2 assay (Roche, Mannheim, Germany) as described previously [13 (link)].

DNA was extracted on a QIAsymphony SP system with the QIAsymphony DSP virus/pathogen kit (Qiagen) according to the manufacturer’s instructions. The DNA concentration was quantified using the Quant-IT double-stranded DNA (dsDNA) high-sensitivity kit (Thermo Fisher Scientific).
Sequencing libraries were prepared from the pure A. baumannii DNA extract samples using the Nextera XT library preparation kit (Illumina Inc.) with slight modifications. One-half of the volume was used for tagmentation reagents, amplification reagents, and input DNA. Library cleanup was performed using the AxyPrep MAG PCR cleanup kit (Corning Inc., NY, USA), and libraries were pooled manually and sequenced on a NextSeq 550 platform with the NextSeq 500/550 midoutput kit v2.5 (300 cycles) (Illumina Inc.). Genome mutations were identified using breseq (39 (link)).

Stored isolates were grown overnight (18–24 hours) on McConkey agar plates, before sub-culturing onto 2% Blood agar. A loop-full of each culture was suspended in 750 μl BashingBead™ Buffer and pre-lysed on the Tissue Lyser in a ZR BashingBead™ Lysis Tube (Zymo Research Corporation), at 50Hz for 5 min. The Lysis tube was centrifuged at 10 000 rpm, and 200 μl of the supernatant extracted and purified using the QIAsymphony DSP Virus/Pathogen Kit (Qiagen), according to the manufacturer’s recommendations.
Using gene-specific primers, selected commonly encountered ESBL and carbapenemase genes were detected and amplified by PCR reaction. The primers used are shown in Table in S1 File and detailed methods are detailed in a recent publication [46 ]. The amplification products were analysed by agarose gel electrophoresis with 1.5%, and visualised with ethidium bromide and using ultraviolet light. Positive amplicons were confirmed with Sanger sequencing, and BLAST analysis.

Sequencing of the two strains was performed at two geographically distant facilities and at different dates (Jena, Germany, and Örebro, Sweden, in spring and autumn 2018, respectively), ruling out any possibility of carry-over contaminations.
Genomic DNA of Dresden-275757 was prepared using a Qiagen kit (Qiagen, Hilden, Germany) after an enzymatic lysis step with lysostaphin, lysozyme and RNAse as previously described [38 (link)–40 (link)]. Afterwards, whole-genome sequencing was carried out using the Illumina HiSeq2500 genome analyser and the Illumina Experiment Manager 1.13.1. (Illumina, Essex, UK). The Nextera XT DNA Library Prep Kit (FC-131-1096; Illumina, San Diego, CA, U.S.A.) and the Nextera XT Index Kit v2, Set A (FC-131-2001; Illumina) were used for preparation of the library according to the manufacturer (Document #15031942 v 02, 2017). An average coverage of 139 was achieved. The reads were assembled to contigs using SPAdes. Sequencing of Oerebro-086360 was performed as previously described [41 (link)]. DNA was automatically extracted using the QIAsymphony DSP Virus/Pathogen kit (Qiagen, Hilden, Germany) following manufacturer’s instructions. Sequencing was done with the Nextera XT kit (Illumina Inc, San Diego, CA, USA) on an Illumina MiSeq. The reads with a coverage of 120 were de novo assembled with version 1.1.04 of Velvet26.

Regarding samples collected from May to July 2021, total RNA was extracted using the EasyMag total nucleic acid extractor (bioMérieux) according to the manufacturer’s instructions. Briefly, 350 µL of the nasopharyngeal sample diluted in lysis/binding buffer was added to EasyMag vessels containing 2 mL bioMérieux lysis buffer. After the addition of 50 µL silica, the samples were incubated at room temperature for 10 min. The elution volume was 55 μL. Nucleic acid extracts were stored at −80°C until further processing.
Samples collected between December 2021 and January 2022 underwent RNA extraction using the QiaSymphony DSP Virus/Pathogen Kit on a QiaSymphony instrument (Qiagen) according to the manufacturer’s instructions. Samples were processed using the Complex400_V4_DSP protocol. A total of 400 µL of lysate was used and the elution volume was 85 µL. Nucleic acid extracts were stored at –80°C until further processing.

Viral RNA was extracted from plasma with the QIAsymphony DSP Virus/Pathogen Kit (Qiagen, Hilden, Germany) and complete NS5A gene amplification was performed using the RT-PCR OneStep kit (Qiagen, Hilden, Germany) using the oligonucleotides NS4BFW (5′TGAGGCGACTVCACCAGTGG3′) and NS5BRV (5′TCTTCCGCGGCRCACGGGGTGA3′). Amplification was programmed as follows: 30 min at 54 °C; 15 min at 95 °C; 35 repetitive cycles of 30 sec at 94 °C, 30 sec at 60 °C and 2 min at 72 °C in the Applied BiosystemsVerityTM Thermal Cycler. Negative and positive controls were included in all amplification procedures. Positive PCR products were visualized with GelRed (Biotium USA) at a HCV specific band size of ~1,343 bp. Amplicons were purified (illustraTMGFXTM PCR DNA and Gel Band Purification Kit, GE Healthcare, USA) and diluted 1:2 using nuclease free water (Roche). Subsequently, the sequencing reaction was performed with the following oligonucleotides: FwSc2 (5′CGACTRCACCAGTGGATAAGC3′); FwSc3 (5′CTRCACCAGTGGATAAGCTCG3′); FwSc5 (5′CCCATTAACGCCTACACCACG3′); FwSc7 (5′CCTGACGCCGAGCTCATAGAG3′); RvSc3 (5′AGCGAGTGTGCATGATGCCAT3′); RvSc7 (5′GTGCGCCTGTCCAGGAATAAGA3′) and Sanger sequencing was performed (ABI PRISM 377 DNA sequencer, Applied Biosystems, Foster City, CA) (with a sensitivity threshold of approximately 15%)^{25 (link)}.