Sybr green dye kit

Total RNA from myocardium cells was extracted with an RNA extraction kit (BioTeke). Single‐stranded cDNA was synthesized from 500 to 1000 ng of RNA using oligo dT‐adaptor primers and an AMV reverse transcriptase kit (Takara) following the manufacturer's instructions. Subsequently, cDNA was amplified with gene‐specific primers and an SYBR Green dye kit (Takara). β‐actin was used as internal reference. The Ct value in 2^−ΔΔCt indicated the relative gene expression.

RNA from PC12 cells and tissues was extracted using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA), while cDNA was generated using the primeScript RT reagent kit (TaKaRa, Otsu, Japan) in accordance with the manufacturers' instructions. qRT-PCR was performed using the SYBR® Green Dye kit (TaKaRa, Otsu, Japan) and the Bio-Rad CFX96 system. Relative gene expression levels were calculated using the classic 2^−ΔΔCt method [14 (link)]. The primer sequences were as follows: Lipin-1 forward TATGACACGGCTTGTTCC, reverse GTGGCTGCCCTGTATTTC; β-actin forward CCTAGACTTCGAGCAAGAGA, reverse GGAAGGAAGGCTGGAAGA (Generay, Shanghai, China).

Total RNA from cardiomyocytes was extracted with an RNA extraction kit (BioTeke, Beijing, China) following the manufacturer’s protocol. The RNA was reverse-transcribed to single-stranded cDNA using the AMV Reverse Transcription System (Takara, Dalian, Liaoning, China). Then, cDNA was amplified with a SYBR Green dye kit and gene-specific primers (Takara, Shiga, Japan). Data were normalized to β-actin mRNA levels. Relative gene expression was determined by the 2^−ΔΔCt method.

Total RNA preparations were extracted with TRIzol reagent (TaKaRa, Japan) from the cells and quantified using a NanoDrop (Thermo Fisher Scientific, United States). One microgram of total RNA was reverse transcribed to cDNA using a PrimeScript RT reagent kit (TaKaRa, Japan). Quantitative real-time PCR was performed using amplified cDNA, gene-specific primers, and a SYBR Green dye kit (TaKaRa, Japan) using QuantStudio 3 (Thermo Fisher Scientific, United States). GAPDH was used as the housekeeping gene. The relative gene expression was calculated by the 2^–ΔΔCt method. Mitochondrial DNA content was quantified as described previously (Ulmer et al., 2018 (link)). Genomic and mitochondrial DNA was extracted with a genomic DNA extraction kit (BioFlux, China). The relative content of mtDNA was detected by quantitative real-time PCR using mitochondria-encoded NADH dehydrogenase (mt-ND1 or mt-ND2) primers and normalized to β-globin. All primers were purchased from TSINGKE Biological, and the sequences of the primers are listed in Supplementary Table S1.

Using TRIzol reagent (Takara, Japan), total RNA was obtained from the rat hypothalamus, pituitary, colon and ovary. One microgram of total RNA was reverse transcribed into cDNA using Superscript II reverse transcription kit (Takara, Japan). Then, cDNA obtained by reverse transcription and gene-specific primers and a SYBR Green dye kit (Takara, Japan) were used for amplification. Table 1 shows the forward and reverse primers used for the polymerase chain reaction. β-actin was used as the endogenous control. The amount of mRNA relative to the endogenous control was calculated by the 2^-△△CT method.