True script one step rt pcr kit

RNA samples of primary fibroblasts and cybrids were extracted by Tissue/Cell RNA Rapid Extraction Kit (Aidlab, China) according to the manufacturer’s instruction, and the cDNA was synthesized using 1 μg RNA with TRUE script One Step RT-PCR Kit (Aidlab, China). The relative expressions of mitochondrial H strand, as well as 11 genes (NRF-1, PPARA, TFAM, TFB1M, TFB2M, PPARGC1A, ER1, ER2, ESRRA, ESRRG, and FSHR) were measured by RT-qPCR with specific primers (Supplementary Table 1). GAPDH was used as the internal control (Li et al., 2016b (link)). The baseline adjustment method of the qPCR software (ANALYTIKJENA, Germany) was used to determine the Ct of each reaction. The amplification efficiencies were close to 100%, and all samples were amplified in triplicate. For data analysis, 2^–ΔΔct method was used to calculate the relative level of samples.

Extraction of the total RNA of HCC tumour and normal tissue samples, as well as treated and non-treated HCC cells was performed by using TRIzol reagent (Wanlei Bio, China). Then, the concentration of extracted RNA was determined using a NanoPhotometer spectrophotometer (Implen, Germany). For cDNA synthesis, 2 μg total RNA was added as a template for reverse transcription using a TRUEscript One Step RT-PCR Kit (Aidlab Biotechnologies, China). An ABI7500 system was employed to quantify the levels of miR-30b-3p and TRIM27 in HCC tissues and cells by using PC60-2 x SYBR Green qPCR Mix (Low ROX) (Aidlab Biotechnologies, China). The primer sequences used were as follows: GAPDH, F: 5ʹ- CTGGGCTACACTGAGCACC -3ʹ, R: 5ʹ-AAGTGGTCGTTGAGGGCAATG-3ʹ; U6, F: 5ʹ- TGCGGGTGCTCGCTTCGGCAGC-3ʹ, R: 5ʹ- -CCAGTGCAGGGTCCGAGGT -3ʹ, RT: 5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATATGGAAC -3′; miR-30b-3p, F: 5ʹ- TGCGGAGAGGTTGCCCTTGGTGA −3ʹ, R: 5ʹ- TGCGGGTGCTCGCTTCGGCAGC -3ʹ, RT: 5ʹ- GTCGTATCCAGTGCAGGGTCCGAGGTGCACTGGATACGACGAATTCAC-3ʹ; TRIM27, F: 5ʹ- TGAGCCTAACCCAGATGGAGA-3ʹ, R: 5ʹ- GGCCAAGTCTAGCTCCTCAAG-3ʹ. TRIM27 mRNA level and miR-30b-3p expression levels were normalized using GAPDH and U6 as the internal control, respectively. The 2−ΔΔCt method was used to quantify the transcript level of TRIM27 and miR-30b-3p.