Tetraethylenepentamine

Manufactured by Merck Group

Sourced in United States

Tetraethylenepentamine is a chemical compound used in various industrial applications. It is a colorless, viscous liquid with a characteristic amine odor. Tetraethylenepentamine is primarily utilized as a chemical intermediate in the production of other compounds and materials.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

Tetraethylenepentamine (TEPA) (2 citations)

12 protocols using tetraethylenepentamine

Synthesis of Polyamine N4 (TEP) Derivatives

Check if the same lab product or an alternative is used in the 5 most similar protocols

N4 (TEP) polyamines were synthesized
as we described recently^{37 (link)} according to
a modified procedure of Uchida and co-workers.^{59 (link)} Briefly, to a chilled solution of poly(β-benzyl-l-aspartate) in N-methyl-2-pyrrolidone (NMP)
(Sigma) (2 mL) was added dropwise with stirring 50 equiv of tetraethylenepentamine
(Sigma) diluted 2-fold with NMP. After stirring for 2 h at 0 °C,
the pH was adjusted to 1 with dropwise addition while stirring of
cold 6 N HCl. The resulting solution was dialyzed from a regenerated
cellulose membrane bag (Spectrum Laboratories, 1 kDa MWCO) against
0.01 N HCl followed by distilled water, frozen, and lyophilized to
give a white powder. Polyamines used in this study were characterized
by ¹H NMR spectra in deuterium oxide (Cambridge Isotope
Laboratories) using a Bruker Avance 400 MHz NMR spectrometer at 25
°C: ¹H NMR (400 MHz, D2O) δ 4.72 (s, 1H), 3.64–3.39
(m, 9H), 3.37–3.05 (m, 5H), 3.00–2.62 (m, 4H).

Ludwicki M.B., Li J., Stephens E.A., Roberts R.W., Koide S., Hammond P.T, & DeLisa M.P. (2019). Broad-Spectrum Proteome Editing with an Engineered Bacterial Ubiquitin Ligase Mimic. ACS Central Science, 5(5), 852-866.

+ Open protocol

+ Expand

Amine-Impregnated Mesoporous Alumina Sorbents

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mesoporous γ-Al₂O₃ (particle size ∼6.9 μm, pore size
(mode) ∼16.1 nm)^{49 (link)} was sourced commercially
from Global Thermostat, LLC. Branched poly(ethyleneimine) (PEI-800, M_w ∼800, M_n ∼600 Sigma-Aldrich), tetraethylenepentamine (TEPA, Sigma-Aldrich),
spermine (>97%, Sigma-Aldrich), and spermidine (>99%, Sigma-Aldrich)
were incorporated into the pores of alumina by physical impregnation,
as described elsewhere.^{40 (link)} Briefly, γ-Al₂O₃ in a round-bottom flask was first activated
by evacuating the flask, heating to 80 °C, and holding at 10
mTorr and 80 °C overnight. The activated alumina was then dispersed
in 25 mL of methanol by sonication to form a suspension. Separately,
a requisite amount of amine (based on the desired weight loading)
was dissolved in 5 mL of methanol and stirred for 15 min to dissolve
completely. The amine solution was then added to the Al₂O₃ suspension and stirred overnight at room temperature.
The methanol was removed by rotary evaporation, and the resulting
solid was dried under ∼10 mTorr vacuum at 80 °C (PEI)
or 60 °C (TEPA, spermine, or spermidine) overnight to yield the
amine-incorporated γ-Al₂O₃ sorbents.

Priyadarshini P., Rim G., Rosu C., Song M, & Jones C.W. (2023). Direct Air Capture of CO2 Using Amine/Alumina Sorbents at Cold Temperature. ACS Environmental Au, 3(5), 295-307.

+ Open protocol

+ Expand

Synthesis of 4A-Zeolite from Iranian Kaolin

Check if the same lab product or an alternative is used in the 5 most similar protocols

Iranian Kaolin was employed to synthesize 4A-zeolite. Sodium hydroxide (NaOH) and methanol were procured from Merck. Tetraethylenepentamine (TEPA) and diethanolamine (DEA), both of analytical grades, were used as amines during the adsorbent synthesis and obtained from Sigma Aldrich.

Bahmanzadegan F., Pordsari M.A, & Ghaemi A. (2023). Improving the efficiency of 4A-zeolite synthesized from kaolin by amine functionalization for CO2 capture. Scientific Reports, 13, 12533.

+ Open protocol

+ Expand

Cytotoxicity Evaluation of Graphite-Based Nanomaterials

Check if the same lab product or an alternative is used in the 5 most similar protocols

Graphite, sulfuric acid (98%), phosphoric acid (98%) potassium permanganate, hydrogen peroxide (30 wt.%), hydrochloric acid (38%), ethanol (95%), methanol, acetone, tetraethylenepentamine (TEPA), chlorosulfonic acid, dichloromethane, quercetin (QC), and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were purchased from Sigma (USA). Dimethyl sulfoxide was purchased from Merck company. All the reagents utilized in this article had analytical grades and without further purification. The human colorectal adenocarcinoma cell lines (HT29) were bought from the Pasteur Institute, (Tehran, Iran). The human dermal fibroblast cells (HDF) as a normal cell, isolated from human newborn foreskins at 1 month of age that underwent routine circumcision in Amirkola Children’s Hospital (Babol, Iran).

SADEGHI A., FAELI M., TAJBAKHSH M., ABRI A, & GOLPOUR M. (2022). Synthesis and characterization of amino sulfonic acid functionalized graphene oxide as a potential carrier for quercetin. Turkish Journal of Chemistry, 46(4), 987-998.

+ Open protocol

+ Expand

Preparation and Storage of Bioactive Compounds

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plerixafor and ribociclib were purchased from AdooQ^® Biosciences (United States), and oxcarbazepine and temoporfin were purchased from Cayman Chemical (United States), while dihydroergotoxine, tetraethylenepentamine, and trientine were purchased from Sigma-Aldrich (United States). All drugs were properly stored at −20°C according to the manufacturer’s indications. For each compound, stock solutions of 16.67 mM were prepared by dissolving the powder in either H₂O or 100% DMSO. The pH of aqueous solutions was adjusted when needed.

Antoniciello F., Roncarati D., Zannoni A., Chiti E., Scarlato V, & Chiappori F. (2022). Targeting the Essential Transcription Factor HP1043 of Helicobacter pylori: A Drug Repositioning Study. Frontiers in Molecular Biosciences, 9, 887564.

+ Open protocol

+ Expand

Synthesis and Characterization of HEMA-based Hydrogels

Check if the same lab product or an alternative is used in the 5 most similar protocols

2-Hydroxyethyl methacrylate (HEMA) (purity
99%), poly(acrylic acid) (PAA) (average Mn ≈ 1200 kDa), azoisobutyronitrile
(AIBN) (purity 98%), N,N-methylene-bis(acrylamide)
(MBA) (purity 99%), poly(vinylpyrrolidone) (PVP) (average Mn ≈
1300 kDa), tetraethylenepentamine (TEPA) (purity ≥ 95%), sodium
hydroxide pellets (purity 97%), and copper(II) chloride dihydrate
(purity > 99.0%) were purchased from Sigma-Aldrich and used as
received.
Potassium dihydrogen phosphate (purity ≥ 99.0%) and dipotassium
hydrogen phosphate (purity ≥ 98%) were purchased from Merck
and used as received to prepare a pH 8 buffer. Water was purified
by a Millipore Milli-Q gradient system (resistivity > 18 MΩ·cm).

Guaragnone T., Rossi M., Chelazzi D., Mastrangelo R., Severi M., Fratini E, & Baglioni P. (2022). pH-Responsive Semi-Interpenetrated Polymer Networks of pHEMA/PAA for the Capture of Copper Ions and Corrosion Removal. ACS Applied Materials & Interfaces, 14(5), 7471-7485.

+ Open protocol

+ Expand

Cationic Lignin-Based Bitumen Emulsions

Check if the same lab product or an alternative is used in the 5 most similar protocols

A kraft lignin (referred to as KFT) from Sigma Aldrich (Madrid, Spain) and two lignin samples derived from the bioethanol process with two purification grades, provided by DONG Energy (Fredericia, Denmark) (referred to as BIOeth1 and BIOeth2, respectively), were used as precursors to obtain cationic lignins (C-KFT, C-BIOeth1 and C-BIOeth2). Bioethanol lignins are expected to be the solid residue fraction derived from wheat straw subjected to a hydrothermal pre-treatment followed by enzymatic hydrolysis and sugars fermentation to obtain bioethanol [24 ].
Lignin amination was performed following the Mannich reaction procedure, using tetraethylene pentamine (TEPA) and formaldehyde 37% as reagents, which were both supplied by Sigma Aldrich (Spain).
In the production of the model emulsions, silicone oil (FS100 from Esquim SA, Barcelona, Spain) with an approximate viscosity of 100 mPa·s at ambient temperature was chosen. This viscosity allowed us to easily reproduce at ambient conditions bitumen viscosity prior to its emulsification at high temperature, which is recommended to be less than 200 mPa·s before entering the colloid mill [20 (link)]. Subsequently, for the second part of the study, a bitumen with a penetration grade of 160–220 (Repsol SA, Madrid, Spain) was emulsified.

Yuliestyan A., Partal P., Navarro F.J., Martín-Sampedro R., Ibarra D, & Eugenio M.E. (2022). Emulsion Stabilization by Cationic Lignin Surfactants Derived from Bioethanol Production and Kraft Pulping Processes. Polymers, 14(14), 2879.

+ Open protocol

+ Expand

Characterization of Synthetic Oligonucleotides

Check if the same lab product or an alternative is used in the 5 most similar protocols

Acetonitrile (99.7% purity) was purchased from Alfa Aesar. Deuterated chloroform (CDCl₃), deuterated dimethyl sulfoxide ((CD₃)₂SO), and deuterium oxide (D2O) were purchased at 99.9% purity from Cambridge Isotope Laboratories. Methanol (99.8% purity) was purchased from Acros Organics. Linear Polyethylenimine (2500 Da) was purchased from Polysciences, Inc. Pentaethylenehexamine (PEHA) and tetraethylenepentamine (TEPA) were purchased at 85−90% purity, while diethylenetriamine (DETA) was purchased at 99% purity from Sigma Aldrich. N-ethylpropylamine (NEPA) was purchased at 97% purity from Alfa Aesar. Oligonucleotides with the sequence GCACACATCGGACAGTTTGA were purchased from Synbio Technologies. All aqueous samples were prepared in MilliQ (18.2 MΩ) water.

Mustafa R., Fitian M., Hamilton N.B., Li J., Silva W.R, & Punihaole D. (2022). Molecular Insights Into the Binding of Linear Polyethyleneimines and single-stranded DNA using Raman Spectroscopy: A Quantitative Approach. The journal of physical chemistry. B, 126(42), 8404-8414.

+ Open protocol

+ Expand

Synthesis of Gold Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tetrachloroauric acid (HAuCl₄·3H₂O), sodium borohydride (NaBH₄), polyethylene glycol (PEG, M_w: 1000 g mol⁻¹), toluene diisocyanate (TDI), Congo red (CR) and tetraethylenepentamine (TEPA) were purchased from Sigma Aldrich and used as such.

Murtaza A., Uroos M., Sultan M., Muazzam R, & Naz S. (2021). Enhancing catalytic potential of gold nanoparticles by linear and cross-linked polyurethane blending. RSC Advances, 11(43), 26635-26643.

+ Open protocol

+ Expand

Synthesis and Characterization of Novel Compounds

Check if the same lab product or an alternative is used in the 5 most similar protocols

Methanesulfonic acid (MSA) (≥99.0%), triethylamine (TEA) (≥99.5%), N-methylpyrrolidine [NMP] (99%), and Tetraethylenepentamine (TEPA) (technical grade) were procured from Sigma-Aldrich. Ethylamine (EA) (99%) and diethanolamine (DEA) (98% for synthesis) were procured from Panreac, AppliChem, GmbH, Germany. All chemicals were used as received without any further purification.

Anis A., Alam M., Alhamidi A., Gupta R.K., Tariq M, & Al-Zahrani S.M. (2023). Studies on Polybenzimidazole and Methanesulfonate Protic-Ionic-Liquids-Based Composite Polymer Electrolyte Membranes. Polymers, 15(13), 2821.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!