Platinum 2 taq hot start dna polymerase kit

cDNA was synthesized from RNA with Superscript III Reverse Transcriptase (Invitrogen™, Waltham, MA, USA) and 5 uM of SARS2_S R1 (GGAGACACTCCATAACACTTAA). First round amplification was done with 10 uM of SARS2_S_F1 (GTCTCTAGTCAGTGTGTTA) and 10 uM SARS2_S_R1 and the Platinum™ II Taq Hot-Start DNA Polymerase kit (Invitrogen™, Waltham, MA, USA). Then, 5 uL of cDNA was mixed with 4 uL 10x buffer, 0.4 uL of dNTP as well as each primer, 0.16 uL Taq, and 9.64 molecular grade water. Thermal cycling parameters were as follows: initial denaturation at 94 °C for 2 min; 35 cycles of denaturation at 94 °C for 15 s, annealing at 50 °C for 15 s, and elongation at 68 °C for 15 s. The product (2 uL) was used as template for a second-round of amplification with 10 uM of each primer: SARS2_S_F2 (CCCCTGCATACACTAATTCTT) and SARS2_S_R2 (AAACTTCACCAAAAGGGCACAAG). The reaction volumes were the same as in the first round with a total reaction volume of 20 uL. Conditions were also the same except annealing at 55 °C and resulted in a 900 kb product. PCR products were purified and sequenced at Inqaba Biotec, South Africa.

Nucleic acid from homogenized mosquitoes was extracted individually, using the NucleoSpin DNA Insect Kit (Macherey-Nagel GmbH & Co. KG, Düren, Germany), following the manufacturer’s instructions. The mitochondrial COI region was amplified using the primer combination LCO1490 and UEA8 (targeting a ~1000 bp long fragment) [29 (link), 30 (link)], and PCR reactions were performed with the Platinum II Taq Hot-Start DNA Polymerase kit (Invitrogen, CA, USA), using 0.5 μl of the enzyme, 2 μl of 10x buffer, 0.6 μl of 50mM MgCl₂, 1–1 μl of the forward and reverse primer solutions (10 μM), 0.2 μl dNTP mix (Promega, USA), 14.7 μl nuclease-free water, and used 2 μl of the DNA extract as a template. The PCR protocol included 5 cycles with the following parameters: 30 sec at 94°C, 30 sec at 45°C, and 1 min at 72°C, followed by 35 cycles of denaturation for 30 sec at 94°C, annealing for 1 min at 51°C, and 1 min of elongation at 72°C, ending with a final extension step at 72°C for 10 minutes. PCR products were purified using NEBMonarch PCR and DNA Clean-up Kit (New England Biolabs, USA), following the manufacturer’s instructions. The sequencing was processed by Eurofins Genomics Custom DNA Sequencing service (Eurofins Genomics, Germany).