Log In Sign up
The largest database of trusted experimental protocols

Hek293 t cells

Manufactured by Agilent Technologies
Visit Supplier
Sourced in United States, China

HEK293 T cells are a commonly used human embryonic kidney cell line derived from human embryonic kidney cells. These cells are often used in biological research, including the study of gene expression, protein production, and the development of vaccines and therapeutics.

Automatically generated - may contain errors

Lab products found in correlation

Pmir glo luciferase gene, by Promega (2 mentions) Synergy 2 multi detection microplate reader, by Agilent Technologies (2 mentions) Iodixanol, by Merck Group (1 mentions) Pluronic f68, by Merck Group (1 mentions) Phelper, by Agilent Technologies (1 mentions) Synergy 2 multidetector microplate reader, by Agilent Technologies (1 mentions)

Close spelling variants of this product

HEK293 cells HEK293

5 protocols using hek293 t cells

1

AAV vector production and administration

Check if the same lab product or an alternative is used in the 5 most similar protocols
AAV vectors were produced in HEK293T cells (Agilent Technologies) and purified
using iodixanol (Sigma-Aldrich) density gradients (Zolotukhin et al., 1999 (link)). To reduce iodixanol thickness for intravenous
injection, AAV vectors were diluted in phosphate-buffered saline (PBS)/5% sorbitol at a
ratio of 5:1. AAV vectors were also produced by Virovek in insect cells using the
baculovirus expression system (Chen, 2008 (link)). AAV
vectors from Virovek were purified using cesium chloride gradients and diluted in PBS
containing 0.001% pluronic F-68 (Sigma-Aldrich) for intravenous injection. Mice were
intravenously injected via the tail vein with 4 × 1011 viral genomes of
each vector unless otherwise specified. Vector injections were performed slowly and the
volume was limited to 300 μL for tail vein injection and 50 μl for
intrahepatic injection.
Rezvani M., Español-Suñer R., Malato Y., Dumont L., Grimm A.A., Kienle E., Bindman J.G., Wiedtke E., Hsu B.Y., Naqvi S.J., Schwabe R.F., Corvera C.U., Grimm D, & Willenbring H. (2016). In Vivo Hepatic Reprogramming of Myofibroblasts with AAV Vectors as a Therapeutic Strategy for Liver Fibrosis. Cell stem cell, 18(6), 809-816.
+ Open protocol
+ Expand
2

Generating AAV Constructs for CRX Overexpression

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human CRX (NM_000554) complementary DNA was amplified by PCR with primers 5′-ACTGAATTCCGCGGGCCCGGCCACCATGATGGCGTATATGAAC-3′ and 5′-GATCGCAGGTGAGGCCTAGCTAAGCGTAATCTGGAACATCGTATGGGTACAAGATCTGAAACTTCC-3′. The 611delC deletion mutation was introduced by PCR with primers 5′- ACTGAATTCCGCGGGCCCGGCCACCATGATGGCGTATATGAAC - 3 ′ and 5′ -GATCGCAGGTGAGGCCTAGCTAAGCGTAATCTGGAACATCGTATGGGTAGGCCGCTGAAATAGGAGC-3′. The PCR products of CRX followed by an HA tag were subcloned into the AAV-green fluorescent protein (GFP) vector (Addgene #32396) with a cytomegalovirus promoter, and substituted for GFP to generate AAV-CRX-wt-HA and AAV-CRX-mut-HA constructs. The Sanger sequencing was carried out for the verification of plasmid constructs.
AAVs were produced by transfection of HEK 293T cells (CRL-11268) with pAAV-RC plasmid, pHelper (Agilent Technologies, CA), and either AAV-CRX-wt-HA, AAV-CRX-mut-HA, or AAV-GFP in a 1:2:1 ratio. Viral titers were approximately 1  ×  1013 vg/mL.
Wang Y., Li X., Yu Y., Liang J., Liu Y., Chen Y., Bai X., Chen J., Wang F., Luo X, & Sun X. (2021). Modeling Cone/Cone–Rod Dystrophy Pathology by AAV-Mediated Overexpression of Mutant CRX Protein in the Mouse Retina. Translational Vision Science & Technology, 10(7), 25.
+ Open protocol
+ Expand
3

Luciferase Reporter Assay for mRNA 3'-UTR Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols
Target gene analysis was performed using the online database of StarBase
biological prediction website (http://starbase.sysu.edu.cn/). The full length of the 3′
untranslated region (3′-UTR) of the FOXP1 mRNA or full-length NEAT1 mRNA was
cloned and amplified, then the PCR product was cloned into the polyclonal loci
downstream of the pmir-GLO luciferase gene (Promega, Madison, WI, USA). Cells
co-transfected were in HEK293 T cells (Shanghai, china), and the luciferase
activity was measured using a Synergy 2 Multi-detector Microplate Reader (BioTek
Instruments, Inc., Winooski, VT, USA). The experiment was independently repeated
three times. Data were normalized for transfection efficiency by dividing
firefly luciferase activity by Renilla luciferase activity.
Pan W., Wu A., Yu H., Yu Q., Zheng B., Yang W., Tian D., Gao Y, & Li P. (2020). NEAT1 Negatively Regulates Cell Proliferation and Migration of Neuroblastoma Cells by miR-183-5p/FOXP1 Via the ERK/AKT Pathway. Cell Transplantation, 29, 0963689720943608.
+ Open protocol
+ Expand
4

Dual-Luciferase Reporter Assay for miRNA Targets

Check if the same lab product or an alternative is used in the 5 most similar protocols
Target gene analysis was performed using the online database of StarBase biological prediction website (http://starbase.sysu.edu.cn/). The full length of the 3′-untranslated region (3′-UTR) of SIRTI or HCG11 was amplified, and then the PCR product was cloned into the polyclonal loci downstream of the pmir-GLO luciferase gene (Promega, Madison, WI, USA). The plasmids were co-transfected into HEK-293T cells (Shanghai, China), and the luciferase activity was measured using a Synergy 2 Multi-detection Microplate Reader (BioTek Instruments, Inc., USA). The experiment was independently repeated three times. Data were normalized for transfection efficiency by dividing firefly luciferase activity from Renilla luciferase activity.
Li D., Liu Y., Gao W., Han J., Yuan R., Zhang M, & Ge Z. (2020). LncRNA HCG11 Inhibits Adipocyte Differentiation in Human Adipose-Derived Mesenchymal Stem Cells by Sponging miR-204-5p to Upregulate SIRT1. Cell Transplantation, 29, 0963689720968090.
+ Open protocol
+ Expand
5

Luciferase Assay for 3'-UTR Interaction

Check if the same lab product or an alternative is used in the 5 most similar protocols
Target gene analysis was performed using the online database of StarBase biological prediction website (http://starbase.sysu.edu.cn/). The full length of the 3' untranslated region (3'-UTR) region of the SIRTI or HCG11 were cloned and ampli ed, then the PCR product was cloned into the polyclonal loci downstream of the pmir-GLO luciferase gene (Promega, Madison, WI, USA). Cells co-transfected were in HEK293T cells (Shanghai, china), and the luciferase activity was measured using a Synergy 2 Multi-detection Microplate Reader (BioTek Instruments, Inc.). The experiment was independently repeated three times. Data were normalized for transfection e ciency by dividing re y luciferase activity by Renilla luciferase activity.
Li D., Liu Y., Gao W., Han J., Yuan R., Zhang M., & Ge Z. (2020). LncRNA HCG11 inhibits adipocyte differentiation in human adipose-derived mesenchymal stem cells by sponging miR-204-5p to upregulate SIRT1.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!