Smart silencer

Motor neuron progenitors were transfected with lncRNA Smart Silencer (RiboBio Co., Guangzhou, China) to knock down the expression of NCM1-AS. The lncRNA Smart Silencer contained a mixture of three siRNAs and three antisense oligonucleotides. The target siRNA sequences were as followed: 5′-ACAACCCGATGACAGCAGA-3′, 5′-CCAAATGGAGAACGTGCAA-3′and 5′-GTACTCGGTCTTTGCTGGC-3′. The target antisense oligonucleotides sequence were as followed: 5′-ATGAAAGGAAAGGCACCAGC-3′, 5′-ACATCTAACAAGGAGGACAC-3′, 5′-AGGTTGACCGCAATGCACAT-3′. The negative control (NC) Smart Silencer did not contain domains sequences homologous to those of humans, rats, or mice. The cells were transfected with the lncRNA Smart Silencer using Lipofectamine 3000 (Invitrogen, USA) and collected 48 h after transfection for RNA isolation.

For the overexpression experiments, full length of the transcript (HSALNT0217290) for HSALNG0104472 was cloned into the lentiviral vector PCDH-CMV-MCS-EF1a-gfp-T2A-puro, the empty vector was used as control. For the stable knockdown experiments using shRNA, a complementary sequence (AGGGAACCAGCTTCAGAACTCAAGAGGTTCTGAAGCTGGTTCCCTTTTTTT) targeting the HSALNG0104472 transcript was inserted into the lentiviral vector pLVX-shRNA2-zsGreen-PGK-puro. The corresponding scramble sequence (CGTATACCCGGAACAAAGGTCAAGAGCCTTTGTTCCGGGTATACGTTTTTT) was used as the control. The constructed lentiviral plasmids were respectively transfected into HEK293 cells with the packaging plasmids psPAX2 and pMD2·G by Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) to produce virus. AC16/iPSCs were infected with the lentiviruses following puromycin treatment for several days to obtain the overexpression and knockdown cell lines. Knockdown experiments were also repeated through transient transfection with a Smart Silencer (mixture of small interfering RNAs and antisense oligonucleotides targeting HSALNG010447, synthesized by RiboBio, Guang Zhou, China). The Smart Silencer was transfected in iPSCs or cardiomyocytes with the Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA, USA) The silencer sequences were listed in Supplementary Table 3.

smart silencers targeting the lncRNA SNHG26 and siRNAs targeting NCL were synthesized by RiboBio (Guangzhou, China). GC cells were seeded in 6-well plates, and after cell adherence, the smart silencer and siRNAs were transfected at a final concentration of 50 nM using Lipofectamine RNAiMAX (Invitrogen). The indicated cells were harvested for protein extraction and proliferation, migration, and invasion assays after transfection for 48 h.