Agarose gel

Amplicons from steps 1 and 2 PCR assays were run in 2% agarose gels (Promega, USA) with 15% GelRed^TM nucleic acid gel stain (Biotium, USA) at 280 V for 30 min (Bio-Rad, USA) using 1× Tris-Acetic Acid-EDTA (TAE) as running buffer. Amplicons from steps 3 and 4 PCR assays were run in 3% agarose gels (Promega, USA) with 15% GelRed^TM nucleic acid gel stain (Biotium, USA) at 280 V for 50 min (Bio-Rad, USA). Amplicon sizes were estimated using 100-bp plus molecular weight marker (Kapa Biosystems, USA). Gels were viewed under UV using a gel documentation system (Vilber Lourmat, France).

Tail tips were incubated in lysis buffer (0.1 M Tris, 5 mM EDTA, 200 mM NaCl, 0.2% SDS) and with 30 μl of Proteinase K (10 mg/ml; Sigma–Aldrich, Darmstadt, Germany) overnight at 54°C. The next day, samples were centrifuged at 4,000 ×g for 10 min. The supernatants were mixed with 500 μl of isopropanol (Sigma–Aldrich, Darmstadt, Germany) for DNA precipitation. Samples were centrifuged (16,000 ×g, 5 min) and washed with 70% ethanol (Roth, Karlsruhe, Germany) two times, then the pellet was air-dried and the DNA was dissolved at 56°C for 30 min in 10 μl of nuclease free water.
Fifty nanograms of DNA in 50 μl reaction mix (5 μl of 10x DreamTaq^TM Green Buffer, 5 μl of 100 mM dNTP mix, 0.1 μM forward primer (either wt: GATAACCAAGATTTCTGCGACATTGC or PGLYRP3KO: TGCGAGGCCAGAGGCCACTTGTGTAGC), 0.1 μM reverse primer (common: TTCTGCAGCACTCTCTCCTCCATAG) (TIB MOLBIOL GmbH, Berlin, Germany), 1.25 μl of DreamTaq^TM DNA Polymerase) were amplified with the following cycling conditions: 3 min at 95°C, 30 cycles with 30 s at 95°C, 30 s at 64°C and 2 min at 72°C and a final step of 7 min at 72°C. PCR products were run on a 1% agarose gel (Promega, Mannheim, Germany) with 0.04% ethidium bromide (Invitrogen, Waltham, MA, United States). The bands were visualized under UV-light.

RAPD-PCR fingerprinting was performed according to Ramadass et al. [20 (link)] using B11 (5′-CCG GAA GAA GGG GCG CCA T-3′) and B12 (5′-CGA TTT AGA AGG ACT TGC ACA C-3′) primers with some modifications. The reaction was carried out in a final volume of 25 μl containing 1X PCR buffer, 1.5 mM MgCl₂, 200 μM each of dNTPs, 0.3 μM of each primer, 1 U of Taq DNA polymerase (Intron, Biotechnology, South Korea) and 100 ng of DNA template. The cycling conditions consisted of two cycles of denaturation at 95 °C for 5 min, annealing of primers for 5 min at 40 °C, and extension for 5 min at 72 °C. The subsequent 35 cycles consisted of denaturation for 1 min at 95 °C, annealing of primers for 1 min at 60 °C, and extension for 3 min at 72 °C, with a final extension step for 10 min during the last cycle. PCR products were analyzed by electrophoresis through a 1 % agarose gel (Promega, Madison, USA).