Px330

KO was performed as recently described [51 (link), 52 (link)] using pX330 and pCAG-EGxxFP [53 (link)] purchased from Addgene (Watertown, MA, USA). For CRISPR/Cas9-based CD98hc (SLC3A2) gene disruption, guide (g) RNA sequences (5′-GCCGCGTTGTCGCGAGCTAC-3′) corresponding to the CD98hc gene (318-bp ~ 337-bp from the initiation ATG site) were designed using CRISPR direct (https://crispr.dbcls.jp/). The efficiency of KO by pX330 plasmids expressing codon-optimized SpCas9 and chimeric gRNA was confirmed by double-strand break-mediated enhanced GFP reconstitution with co-transfection of pX330 and pCAG-EGxxFP plasmids into HEK293 cells. Cells were seeded into 35-mm dishes (BD BioCoat, Franklin Lakes, NJ, USA) in 1 mL of RD medium, grown to 80% confluency, and plasmid DNA (5 μg) was introduced into cells using Xfect transfection reagent (Takara Bio Inc., Shiga, Japan). In the case of SW1116 cells, co-transfection of pX330 and pUC19 (#3219, Takara) containing the puromycin-resistant gene was carried out, and cells were cultured with puromycin (Invitrogen, 2 μg/mL) for 10 days.

MEFs were grown in Dulbecco’s modified Eagle medium (DMEM) containing 10% fetal bovine serum (FBS), 5 U/mL penicillin, and 50 μg/mL streptomycin. K562 cells (JCRB0019) were grown in RPMI 1640 medium containing 10% fetal bovine serum, 5 U/mL penicillin, and 50 μg/mL streptomycin. To generate ATG2B and GSKIP knockout K562 cells, each guide RNA designed using the CRISPR design tool (http://crispr.mit.edu/) was subcloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (catalog no. 42230; Addgene; deposited by Feng Zhang’s lab), a human codon-optimized SpCas9 and chimeric guide RNA expression plasmid. K562 cells were cotransfected with vectors pX330 and pEGFP-C1 (catalog no. 6084-1; TaKaRa Bio, Inc., Shiga, Japan), and cultured for 2 days. Thereafter, green fluorescent protein (GFP)-positive cells were sorted and expanded. Loss of ATG2B and GSKIP was confirmed by heteroduplex mobility assays followed by immunoblot analysis with anti-ATG2B and anti-GSKIP antibodies.

KO was performed as recently described¹⁸, ²⁵, ³³ using pX330 and pCAG‐EGxxFP³⁴ purchased from Addgene. In CRISPR/Cas9‐based gene disruption, guide (g) RNA sequences (5’‐AGCTGTGGCAGCGTCAACAG‐3′) corresponding to the MET gene (394–413 bp from the initiation ATG site), (5’‐GAGGGCGAACGACGCTCTGC‐3′) HER3 gene (3–22 bp from the initiation ATG site), and FOXM1(5’‐CCGTCGGCCACTGATTCTCA‐3′) gene (15–33 bp from the initiation ATG site) were designed using CRISPR direct (https://crispr.dbcls.jp/). SW1116 cells were used to generate HER3 and/or MET and the FOXM1‐KO cell line using the pX330 (Addgene) and pCAG‐EG × ×FP (Addgene) CRISPR/Cas9 vectors. The gene‐specific region of gRNA sequences was designed by the CRISPR design tool from CRISPR direct (https:/crispr.dbcls.jp/). Single clones were picked up and the KO efficiency was assessed by WB and FCM. Cells were seeded onto 35‐mm dishes (BD BioCoat, Franklin Lakes, NJ, USA) in 1 mL of RD medium, and plasmid DNA (5 μg) was introduced into cells of approximately 80% confluency using Xfect transfection reagent (Takara Bio Inc.). The co‐transfection of pX330 and pUC19 (#3219, Takara Bio) containing the puromycin‐resistant gene was also performed, and cells were cultured with puromycin (Invitrogen, 2 μg/mL) for 10 days.