The FAK inhibitor Defactinib (VS-6063, PF-04554878) was obtained from Selleckchem (Houston, TX, USA). Cisplatin (Cis-Pt) and dimethyl sulfoxide (DMSO) were purchased from Sigma-Aldrich. The compound DVL PDZ-domain inhibitor II 3289-8625 was obtained from Merck, Schaffhausen, Switzerland (catalog number 322338). All compounds were dissolved in DMSO. Medium containing 0.5% DMSO was used as control for the experiments. A concentration of 1 mM IPTG (Isopropyl β-d -1-thiogalactopyranoside; PanReac AppliChem, Axonlab, Baden-Dättwil, Switzerland) was used for the induction of CR downregulation; the medium containing IPTG was replaced every three days.
Cisplatin cis pt
Manufactured by Merck Group
Sourced in United States
Cisplatin (Cis-Pt) is a platinum-based chemotherapeutic agent. It is a coordination complex with the chemical formula cis-[Pt(NH3)2Cl2].
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Merck Group (1 mentions)
Rpmi 1640 liquid medium, by Merck Group (1 mentions)
Tetramethylrhodamine ethyl ester perchlorate tmre, by Merck Group (1 mentions)
Antibodies against β actin, by Merck Group (1 mentions)
Rnase a, by Merck Group (1 mentions)
Propidium iodide, by Merck Group (1 mentions)
Dc protein assay kit, by Bio-Rad (1 mentions)
Ro31 8220, by Merck Group (1 mentions)
Geneart, by Thermo Fisher Scientific (1 mentions)
Bafilomycin a1, by Santa Cruz Biotechnology (1 mentions)
Verteporfin vp, by Merck Group (1 mentions)
Milli q purification system, by Merck Group (1 mentions)
Ethidium bromide, by Merck Group (1 mentions)
Mpeg 5 kda, by Polysciences (1 mentions)
Branched pei 10 kda, by Polysciences (1 mentions)
3 4 5 dimethylthiazol 2 yl 2 5 diphenyltetrazolium bromide, by Merck Group (1 mentions)
5 protocols using cisplatin cis pt
1
Inhibition of FAK, Cisplatin, and CR Downregulation
2
Cell Viability Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
The materials used included: RPMI 1640 liquid medium (Sigma-Aldrich Co, Ltd, USA), fetal bovine serum (FBS) (Sigma-Aldrich Co, Ltd, USA), penicillin/streptomycin and L-glutamine (Merck KGaA (Darmstadt, Germany)), propidium iodide (Sigma-Aldrich Co, Ltd, USA), RNase A (Sigma, USA), tetramethylrhodamine ethyl ester perchlorate (TMRE)(Sigma, USA), antibodies against β-actin (1:2000 dilution) (Sigma, USA), anti-phospho-p38 kinase antibodies (1:1000 dilution) (Cell Signaling, USA), DC Protein Assay kit (Bio-Rad, USA), cisplatin (cis-Pt, Sigma-Aldrich Co, Ltd, USA).
+ Expand
The materials used included: RPMI 1640 liquid medium (Sigma-Aldrich Co, Ltd, USA), fetal bovine serum (FBS) (Sigma-Aldrich Co, Ltd, USA), penicillin/streptomycin and L-glutamine (Merck KGaA (Darmstadt, Germany)), propidium iodide (Sigma-Aldrich Co, Ltd, USA), RNase A (Sigma, USA), tetramethylrhodamine ethyl ester perchlorate (TMRE)(Sigma, USA), antibodies against β-actin (1:2000 dilution) (Sigma, USA), anti-phospho-p38 kinase antibodies (1:1000 dilution) (Cell Signaling, USA), DC Protein Assay kit (Bio-Rad, USA), cisplatin (cis-Pt, Sigma-Aldrich Co, Ltd, USA).
3
MAPK15 Expression Vectors for Cisplatin Sensitivity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pCEFL HA, pCEFL HA MAPK15 [18 (link)], pCEFL HA MAPK15_AXXA and pCEFL HA MAPK15_KD [25 (link)] expression vectors have been previously described. The corresponding cDNA (MAPK15_WT, MAPK15_AXXA and MAPK15_KD), resistant to siRNA for MAPK15 (siMAPK15-1), were synthesized (GeneART, Thermo Fischer Scientific) with “synonymous” mutations in the sequence recognized by the siRNA and cloned in the pCEFL HA expression vector. The identity and integrity of all vectors was confirmed by DNA sequencing. Cis-platin (Cis-Pt; Sigma Aldrich, Milan, Italy) was used at a final concentration of 1 μM. Bafilomycin A1 (Santa Cruz Biotechnology, Heidelberg, Germany) and RO31-8220 (Merck Millipore, Vimodrone, Italy) were used at a final concentration of 100 nM.
4
Synthesis and Characterization of Multifunctional Polymeric Nanocarriers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Poly(lactide-co-glycolide), ester endcap L:G 50:50 (PLGA, Mw ~ 25,000–35,000), poly(ethylene glycol) methyl ether-block-poly(lactide-co-glycolide) (PEG-PLGA, Mw ~ 5000:20,000), poly(lactide-co-glycolide)-folate, L:G 50:50 (FA-PLGA, Mw ~ 25,000–35,000) employed as biocompatible, “stealth” and functionalized “smart” polymers, respectively, for NC stabilization were obtained from PolySciTech® (West Lafayette, IN, USA). Cremophor A25 and didodecyldimethylammonium bromide, di-C12DMAB, applied as a hydrophilic non-ionic and a hydrophobic double chain cationic surfactant, were obtained from BASF Care Creations (Monheim am Rhein, Germany) and Sigma Aldrich (Poznan, Poland), respectively. Verteporfin (VP) and cisplatin (Cis-Pt), utilized as hybrid cargo, were from Sigma-Aldrich (Poznan, Poland). Supplementary chemical compounds were of commercial grade and were used as received. Doubly distilled water was purified using a Milli-Q purification system (Millipore, Bedford, MA, USA).
5
Targeted Cancer Drug Delivery System
Check if the same lab product or an alternative is used in the 5 most similar protocols
Branched PEI 10 kDa and mPEG 5 kDa were respectively supplied from Poly Sciences Inc. (Canada) and Jenkem (USA). Dithiodipropionic acid (DTDP), N-hydroxysuccinimide (NHS), sodium borohydride (NaBH4),1-(3-dimethylamino-propyl)-3-ethylcarbodiimide hydrochloride (EDC), 3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), ethidium bromide (EthBr), cisplatin (cis-Pt), and N-acetyl-(Asp-Glu-Val-Asp)-7-amino-4-trifluoromethylcoumarin (Ac-DEVD-AFC) were provided from Sigma-Aldrich (USA).
A2780S and A2780R cell lines and human umbilical vein endothelial cells (HUVECs) were provided from Pasture Institute (Iran, Tehran). As-21 and scrambled sequences were TCAACATCAGTCTGATAAGCTA and CATTAATGTCGGACAACTCAAT, respectively.
+ Expand
Branched PEI 10 kDa and mPEG 5 kDa were respectively supplied from Poly Sciences Inc. (Canada) and Jenkem (USA). Dithiodipropionic acid (DTDP), N-hydroxysuccinimide (NHS), sodium borohydride (NaBH4),1-(3-dimethylamino-propyl)-3-ethylcarbodiimide hydrochloride (EDC), 3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), ethidium bromide (EthBr), cisplatin (cis-Pt), and N-acetyl-(Asp-Glu-Val-Asp)-7-amino-4-trifluoromethylcoumarin (Ac-DEVD-AFC) were provided from Sigma-Aldrich (USA).
A2780S and A2780R cell lines and human umbilical vein endothelial cells (HUVECs) were provided from Pasture Institute (Iran, Tehran). As-21 and scrambled sequences were TCAACATCAGTCTGATAAGCTA and CATTAATGTCGGACAACTCAAT, respectively.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!