RNA was isolated from FACS-purified MG and MG-derived progenitors at 4 dpi as previously described (Ramachandran et al, 2011 (link), 2012b (link)). Briefly, uninjured and injured retinae were isolated from 1016tuba1a:GFP transgenic fish. GFP+ MGPCs from 1016tuba1a:GFP retinae at 4 dpi were isolated by treating retinae with hyaluronidase and trypsin and then sorted on a BD FACS Aria Fusion high-speed cell sorter. Approximately 30 injured retinae with 10 pokes per retina from 1016tuba1a:GFP fish yielded 70,000 GFP+ and 150,000 GFP− cells.
Facsaria fusion high speed cell sorter
Manufactured by BD
The FACSAria™ Fusion is a high-speed cell sorter designed for precise and efficient cell separation. It utilizes advanced flow cytometry technology to isolate and sort cells based on their unique physical and fluorescent characteristics.
Automatically generated - may contain errors
Lab products found in correlation
Onestep rt pcr buffer, by Qiagen (2 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Phosphate buffered saline (pbs), by Thermo Fisher Scientific (2 mentions)
Ivis lumina 3, by PerkinElmer (1 mentions)
Dneasy blood tissue kit, by Qiagen (1 mentions)
Facsdiva software, by BD (1 mentions)
Clone w6 32, by BioLegend (1 mentions)
Fugene hd transfection reagent, by Promega (1 mentions)
Gene pulser xcell, by Bio-Rad (1 mentions)
Lsrfortessa, by BD (1 mentions)
Navios, by Beckman Coulter (1 mentions)
6 protocols using facsaria fusion high speed cell sorter
1
Isolation of Retinal Müller Glia Progenitors
2
Tracking Breast Cancer Dormancy In Vivo
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ER+ T47D cells were stably transduced for GFP expression using a commercially available lentiviral system, GFP Control Lentiviral Biosensor from MilliporeSigma (catalog no. 17-10387), per the manufacturer’s instructions. Stably transduced cells were isolated using a fluorescence-activated cell sorter (BD FACSAria Fusion High Speed Cell Sorter), passaged multiple times for expansion, and frozen for storage and future use.
For in vivo studies, GFP-expressing ER+ T47D cells were injected into anesthetized mice for studies of breast cancer dormancy per approved IACUC protocol (AUP no. 1311-2016-0). The use of the stably transduced cell lines enabled in vivo monitoring of tumor growth with the IVIS imaging system (PerkinElmer, IVIS Lumina III) and identification of DTCs in excised tissues. Following the completion of imaging at specific time points during the studies, mice were euthanized, and tissues were removed for histochemical analysis to identify dormant DTCs in particular organs and BM harvested for isolation of dormant DTCs.
For in vivo studies, GFP-expressing ER+ T47D cells were injected into anesthetized mice for studies of breast cancer dormancy per approved IACUC protocol (AUP no. 1311-2016-0). The use of the stably transduced cell lines enabled in vivo monitoring of tumor growth with the IVIS imaging system (PerkinElmer, IVIS Lumina III) and identification of DTCs in excised tissues. Following the completion of imaging at specific time points during the studies, mice were euthanized, and tissues were removed for histochemical analysis to identify dormant DTCs in particular organs and BM harvested for isolation of dormant DTCs.
3
Single-Cell Sequencing of Tumor-Infiltrating Lymphocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were thawed and stained with multicolor panels (Suppl. Table 1). Antibodies were used according to the manufacturer’s instructions. TILs and TUM samples from each patient were processed in parallel to minimize instrument and staining variability. For single cell sequencing, single cells were index-sorted directly into 96-well plates pre-filled with OneStep RT-PCR buffer (Qiagen) as previously described.24 For TCRβ repertoire sequencing, bulk cells were FACS-sorted into tubes prefilled with RPMI1640 containing 2% FBS. DNA was isolated immediately after sorting using the DNeasy Blood & Tissue Kit (Qiagen) and stored at 4°C until further processing. All cells were sorted using a FACSAria™ Fusion high-speed cell sorter (BD Biosciences) equipped with a 70 µm nozzle.
4
Single-Cell Immune Phenotyping and TCR Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lymph node cell suspensions were stained with multi-parameter antibody panels (Suppl. Tab. 1) according to the manufacturers’ instructions. Single cell index sorting into 96-well plates pre-filled with OneStep RT-PCR buffer (Qiagen) for T cell receptor (TCR) αβ and phenotype sequencing was done as described previously [7 (link)]. Index sorting guaranteed highly accurate 13-dimensional immune phenotyping of every single sorted cell at the protein level with accurately assigned immune phenotypes in > 99% of sorted T cells [7 (link)]. All cells were sorted using a FACSAria™ Fusion high-speed cell sorter (BD Biosciences) equipped with a 70 µm nozzle and were frozen at -80 ºC immediately after sorting until further processing. Multi-parameter immune phenotyping was performed on all ten patients in the study; sufficient material for single cell index sorting was available from nine out of ten patients. Index sorting data were exported from FACSDiva software (BD Biosciences) as “comma-separated values” (.csv) files according to the manufacturer’s instructions and combined with single cell sequencing data.
5
CRISPR-Mediated HLA Knockout Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following guide RNAs (5′ → 3′) were used for HLA knockout: ACAGCGACGCCGCGAGCCAG (HLA-A), CGTACTGGTCATGCCCGCGG (HLA-B), and GACACAGAAGTACAAGCGCC (HLA-C). All guide RNAs were coded within pSpCas9 plasmids (GenScript). JJN-3 and U266B1 cells were transfected by electroporation (Gene Pulser Xcell, Bio-Rad), and HEK293T were transfected with FuGENE HD Transfection Reagent (Promega). HLA-knockout cell lines were expanded for 4 to 6 weeks from single cells sorted on a FACSAria Fusion high-speed cell sorter (BD Biosciences) equipped with a 70-μm nozzle. Cell culture conditions are specified in the cell line section. HLA knockout was confirmed by flow cytometry using antibodies against HLA-B7 (clone BB7.1, BioLegend, RRID: AB_2650776), HLA-C (clone DT9, BD Biosciences, RRID: AB_2739715), or HLA-class I (clone W6/32, BioLegend, RRID: AB_493669) according to the manufacturer's instructions.
6
Multiparameter Flow Cytometry Analysis of Diverse Cell Sources
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells isolated from bone marrow, peripheral blood, and cell lines were stained with multiparameter panels according to the manufacturer's instructions. Briefly, up to 5 × 106 cells were washed in pure phosphate-buffered saline (PBS, Thermo Fisher Scientific), centrifuged at 300 × g, supernatant was decanted, and cells were stained with the indicated antibodies at 4°C for 30 minutes protected from light. After staining, cells were washed with PBS containing 2% FBS (Thermo Fisher Scientific) and resuspended in 100 μL PBS containing 2% FBS for subsequent analysis or sorting. Index sorting for single-cell sequencing was done using a FACSAria Fusion high-speed cell sorter (BD Biosciences) equipped with a 70-μm nozzle as previously described (19, 20 (link)). Antibodies used for index sorting are listed in Supplementary Table S2. Flow cytometry for cell analysis was performed using LSRFortessa (BD Biosciences), Navios (Beckman Coulter), or Aurora (Cytek) instruments.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!