Human cervical carcinoma cells were seeded at 50% confluence on glass slides and incubated at 37 °C. When the density of cells reached 70–80%, the GFP-RFP-LC3 plasmid (Addgene, Watertown, MA, USA) was transfected using lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, lnc.) in accordance with the instructions of transfection reagent. New RPMI media containing 0.5% FBS was replaced after transfected for dd4 h. Subsequently, Cells were treated with indicated concentration of MAC and CQ. After treatment with these drugs for 24 h, cells were fixed using 100% methanol. Then, cells were stained with DAPI for 4 min before being covered with anti-fade fluorescent mounting medium (Dako). Fluorescent signals were visualized by an automated microscope (Biotek, Agilent Technologies, Santa Clara, CA, USA).
Gfp rfp lc3 plasmid
Manufactured by Addgene
Sourced in United States
The GFP-RFP-LC3 plasmid is a molecular biology tool that contains the coding sequences for green fluorescent protein (GFP), red fluorescent protein (RFP), and the microtubule-associated protein 1 light chain 3 (LC3) protein. This plasmid can be used for the study of autophagy, a cellular process involved in the degradation and recycling of cellular components.
Automatically generated - may contain errors
Lab products found in correlation
Anti fade fluorescent mounting medium, by Agilent Technologies (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Bx50 fluorescence microscope, by Olympus (1 mentions)
Recombinant human tgf β1, by R&D Systems (1 mentions)
Gelatin solution, by Merck Group (1 mentions)
Phenol red solution, by Merck Group (1 mentions)
Horse serum, by Thermo Fisher Scientific (1 mentions)
Almond β glycosidase, by Merck Group (1 mentions)
Chloroquine cq, by Merck Group (1 mentions)
Earle s salt, by Merck Group (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Medium 199, by Merck Group (1 mentions)
Pancreatin, by Merck Group (1 mentions)
Oleuropein, by Extrasynthese (1 mentions)
5 protocols using gfp rfp lc3 plasmid
1
Autophagy Induction in Cervical Cancer
2
Naringenin Modulates Autophagic Flux
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To examine the impact of Naringenin on autophagic flux, the GFP‐RFP‐LC3 plasmid (Addgene) was employed. To elucidate the involvement of autophagy and AMPK signaling in the suppression of macrophage activation by Naringenin, we generated plasmids containing targeted shRNA sequences targeting Atg5 and Ampkα, respectively. The lentivirus‐based pLKO vector was utilized to express the shRNA. The specific shRNA sequences employed in this study were obtained from the Sigma shRNA Mission library and are listed below:
shAtg5 (5′‐CCGGAGCCTCCTCTTCTCGTGAAATCTCGAGATTTCACGAGAAGAGGAGGCTTTTTTG‐3′)
shAmpkα (5′‐CCGGTTGTTGGATTTCCGTAGTATTCTCGAGAATACTACGGAAATCCAACAATTTTTG‐3′)
Sequences of all oligonucleotides used in this study are available upon request.
shAtg5 (5′‐CCGGAGCCTCCTCTTCTCGTGAAATCTCGAGATTTCACGAGAAGAGGAGGCTTTTTTG‐3′)
shAmpkα (5′‐CCGGTTGTTGGATTTCCGTAGTATTCTCGAGAATACTACGGAAATCCAACAATTTTTG‐3′)
Sequences of all oligonucleotides used in this study are available upon request.
3
GFP-RFP-LC3 Plasmid Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cells were then transfected with a GFP-RFP-LC3 plasmid (Addgene Plasmid #84573) using LipofectamineTM2000 and 24 h later, the cells were transferred onto coverslips. The cells were washed with PBS and fixed with 4% PFA in PBS for 30 min at room temperature. The fixed cells were washed twice with PBS and then permeabilized with 0.5% Triton X-100 in PBS for 2 min on ice. Images were obtained under an Olympus BX50 fluorescence microscope (Olympus).
4
Isolation and Culture of Primary Mouse Mesangial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary mouse MC (MMCs) were isolated and cultured using renal glomeruli from wild type mice and miR-192-KO mice as described before13 (link),38 (link). Recombinant human TGF-β1 was from R&D Systems, Inc. (Minneapolis, MN, USA). miR-192 mimics (192-M), miR-217 mimics (217-M), negative control oligonucleotides (NC) were obtained from Dharmacon (Lafayette, CO). RFP-GFP-LC3 plasmid was obtained from Addgene. MC were transfected with miRNA mimics or RFP-GFP-LC3 plasmid using a Nucleofector and Basic Nucleofector Kit (Lonza). Cells were serum depleted and treated with TGF-β for the indicated time periods.
5
Oleuropein-Mediated Autophagy Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oleuropein was from Extrasynthese (Lyon, France). DMEM (high glucose + GlutaMAX), HAM F-12, fetal bovine serum (FBS), and horse serum were purchased from Gibco, Life Technologies. Medium 199, Earle's salts, pancreatin, gelatin solution, phenol red (solution), Percoll, chloroquine (CQ), and almond β-glycosidase were from Sigma-Aldrich. Collagenase A (Clostridium hystolyticum) was from Roche. Ad-MAO-A adenovirus was made as previously described [4 (link)]. RFP-GFP-LC3 plasmid was from Addgene (Cambridge, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!