Cdna synthesis kit

Manufactured by EURx

Sourced in Poland

The cDNA Synthesis Kit is a laboratory tool used to convert RNA into complementary DNA (cDNA) molecules. This process involves the reverse transcription of RNA templates into single-stranded cDNA, which can then be used for various downstream applications such as gene expression analysis, cloning, and sequencing.

Automatically generated - may contain errors

Lab products found in correlation

Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions) Trizol reagent, by GeneAll (2 mentions) Universal dna rna protein purification kit, by EURx (1 mentions) Sg qpcr master mix, by EURx (1 mentions)

Spelling variants of this product

Smart First Strand cDNA Synthesis Kit (7 citations)

3 protocols using cdna synthesis kit

Quantitative Gene Expression Analysis of Spinal Cord Injury

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from injured spinal cord tissues using Universal DNA/ RNA/Protein Purification kit (EURx, Poland), then RNA concentrations were determined using the nanodropper; cDNA was synthesized from isolated RNA via cDNA synthesis kit (EURx,E0801-02, Poland). Amplification and real-time detection were performed on an ABI model Stepone (Thermo fisher scientific, USA) using SG qPCR Master mix (EURx, E0402-01, Poland) and QuantiTect primers (Cinna Gen, Iran). The improved four-step reaction was used: 95 °C 10 min; 95 °C 10s, 60 °C 30 s, 72 °C 30 s, and 85 °C 15 s, for 40 cycles; the melting curve analysis was done with the temperature ranging from 60 to 95 °C, gradually increasing at a speed of 0.5 °C every 10 s. Relative quantitative analysis of the final results was normalized to beta-actin (Table 2).Table 2

Sequence of primer pairs for real-time PCR

Primer name	Sequence 5′-3′
IL-6 (forward)	GACTGATGTTGTTGACAGCC
IL-6 (reverse)	CTGACAGTGCATCATCGCTG
BDNF (forward)	GGCTGACACTTTGAGCACG
BDNF (reverse)	GCTGTGACCCACTCGCTAA
GDNF (forward)	TATGGGATGTCGTGGCTGTC
GDNF (reverse)	CGCCGCTTGTTTATCTGGTG
Beta-actin (forward)	GGCAAGGTCATCCCAGAGC
Beta-actin (reverse)	CATCATACTTGGCAGGTTTCTCC

IL-6 interlukin6, BDNF brain-derived neurotrophic factor, GDNF glial cell line-derived neurotrophic factor

Sarveazad A., Janzadeh A., Taheripak G., Dameni S., Yousefifard M, & Nasirinezhad F. (2019). Co-administration of human adipose-derived stem cells and low-level laser to alleviate neuropathic pain after experimental spinal cord injury. Stem Cell Research & Therapy, 10, 183.

+ Open protocol

+ Expand

RNA Extraction and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA extraction was extracted from MC4-L2 cell line-treated and tumor tissues of mice using TRIZOL reagent (Gene All, South Korea), according to the manufacturer's instructions. RNA concentrations were determined using the NanoDrop spectrophotometer (Thermo Scienti c, Germany). The quality of extracted RNA was assessed by 1% agarose gel electrophoresis. After RNA extraction, the complementary DNA (cDNAs) were synthesized using a cDNA synthesis kit (EURx, Poland), according to the manufacturer's instructions.

Rezaei S., Azarpira N., Koohpeyma F., Yousefi R., Heidari M., Doaei S., Haghshenas M.R., & Mazloom Z. (2022). In-vitro and In-vivo effects of Cu-Melo Seed´trypsinseed´trypsin Inhibitor on Angiogenesis and Tumor Characteristics in Balb-c Mice With Breast Cancer.

+ Open protocol

+ Expand

Total RNA Extraction and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA extraction was extracted from MC4-L2 cell line treated and tumor tissues of mice using TRIZOL reagent (Gene All, South Korea), according to the manufacturer's instructions. RNA concentrations were determined using the NanoDrop spectrophotometer (Thermo Scienti c, Germany). The quality of extracted RNA was assessed by 1% agarose gel electrophoresis. After RNA extraction, the complementary DNA (cDNAs) were synthesized using a cDNA synthesis kit (EURx, Poland), according to the manufacturer's instructions.

Haghshenas M.R., Rezaei S., Azarpira N., Koohpeyma F., Yousefi R., Heidari M., Doaei S., & Mazloom Z. (2022). In vitro and In vivo effects of Cucumis melo seeds extract and its purified trypsin inhibitor on angiogenesis and tumor characteristics in balb-c mice with breast cancer in comparison with tamoxifen.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!