Te buffer ph 8

Messenger RNA was extracted and quantified by quantitative real time PCR (qRTPCR) as described previously35 or using the allele specific primer kit for RS2075245 (Life Technologies). PCR values for H19 (obtained from 11 controls, 34 normal FFMI patients, and 22 low FFMI patients) were normalized to the geomean of RPLPO and HPRT. Primers were H19: For‐TGCTGCACTTTACAACCACTG, Rev‐TGGTGTCTTTGATGTTGGGC RPLPO: For‐TCTACAACCCTGAAGTGCTTGATATC, Rev‐GCAGACAGACACTGGCAACATT and HPRT: For‐GCTATAAATTCTTTGCTGACCTGCTG ,Rev‐AATTACTTTTATGTCCCCTGTTGACTGG. MicroRNA expression was analysed in trizol extracted RNA. RNA isolated muscle was reverse transcribed using MultiScribe™ Reverse Transcriptase with, Megaplex™ RT Primers (human pools A and B, Version 3.0, Applied Biosystems) according to the manufacturer's instructions. The reactions were terminated by heat deactivation at 85°C for 5 min and the cDNA stored at −80°C. The cDNAs were pre‐amplified using Megaplex™ PreAmp Primers (Applied Biosystems) for 12 cycles of 95°C for 15 s and 60°C for 4 min. The reaction was terminated by heating to 99.9°C for 10 min and pre‐amplified cDNA diluted by addition of 75 μL of 0.1× TE buffer pH 8.0 (Qiagen) and stored at −80°C.

miRNAs were reverse transcribed using MultiScribe Reverse Transcriptase and Megaplex RT Primers (human pool A, Version 3.0; Applied Biosystems) according to the manufacturer’s instructions. The samples were heated to 85°C for 5min to terminate the reactions then stored at −80°C. The cDNAs were preamplified using Megaplex PreAmp Primers (Applied Biosystems) for 12 cycles of 95°C for 15 s and 60°C for 4 min, and the reactions were terminated by heating to 99.9°C for 10 min. The resulting cDNA was diluted to 100 μl by addition of 0.1× TE buffer pH 8.0 (Qiagen) and stored at −80°C. Primers and probes for miR-542-3p and miR-542-5p were purchased for each test gene from Applied Biosystems, and amplification was carried out according to the manufacturer’s instructions. Each reaction was performed in duplicate, and the average Ct value was normalized to the corresponding geometric mean of U6 and RNU48 using the ΔΔCt method. RNA isolated from cells was analyzed using single RT reactions.