Quantstudio systems

Manufactured by Thermo Fisher Scientific

Sourced in United States

The QuantStudio™ systems are a series of real-time PCR instruments designed for accurate and reproducible quantitative and qualitative nucleic acid analysis. These systems offer a range of block formats and software options to meet various experimental needs.

Automatically generated - may contain errors

Lab products found in correlation

High capacity rna to cdna kit, by Thermo Fisher Scientific (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Powerup sybr green master mix, by Thermo Fisher Scientific (1 mentions) Gotaq probe 1 step rt qpcr system, by Promega (1 mentions) Abi 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

QuantStudio 12K Flex system (147 citations) ABI QuantStudio 6 Flex Real-Time PCR System (32 citations) QuantStudio 5 Real-Time PCR Detection System (20 citations) Applied Biosystems QuantStudio 7 Flex Real-Time PCR System (15 citations) QuantStudio 7 PCR System (12 citations) ABI QuantStudio 12K Flex Real-Time PCR System (7 citations) QuantStudio 3 and 5 systems (5 citations) QuantStudio S5 Real-time PCR system (4 citations) QuantStudio 7 Flex Real-Time system (4 citations) QuantStudio 5 rtPCR Systems (3 citations)

2 protocols using quantstudio systems

Comprehensive RNA Extraction and qPCR Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using TRIzol reagent (catalog number: 15596026, Invitrogen, Thermo Fisher Scientific, Carlsbad, CA, USA) and cDNA synthesis was performed using 1 ug RNA and High-Capacity RNA-to-cDNA kit (catalog number: 4388950, Applied Biosystems™, Thermo Fisher Scientific, Carlsbad, CA), according to the manufacturer’s instructions. Real-time PCR was performed using PowerUp™ SYBR™ Green Master Mix (catalog number: A25743, Applied Biosystems ™, Thermo Fisher Scientific, Carlsbad, CA, USA) on QuantStudio™ systems with respective software (Applied Biosystems™, Thermo Fisher Scientific, Carlsbad, CA, USA). Gene expression was normalized with CypA, Rps9, Gak, and Srp72 as housekeeping genes by using geNorm application [41 (link)]. Primer sequences are described in Table S1.

Correia de Sousa M., Calo N., Sobolewski C., Gjorgjieva M., Clément S., Maeder C., Dolicka D., Fournier M., Vinet L., Montet X., Dufour J.F., Humar B., Negro F., Sempoux C, & Foti M. (2021). Mir-21 Suppression Promotes Mouse Hepatocarcinogenesis. Cancers, 13(19), 4983.

+ Open protocol

+ Expand

CHIKV RNA Detection by RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Reverse transcription quantitative real-time PCR (RT-qPCR) was performed on samples using the GoTaq® Probe 1-Step RT-qPCR System (PROMEGA) on an ABI7500 Real Time PCR Systems or a QuantStudio® Systems (Applied Biosystems). The CHIKV non-structural protein 1 (nsp1) was targeted using the primers CHIKV-F (5’ to 3’: AAAGGGCAAACTCAGCTTCAC), CHIKV-R (5’ to 3’: GCCCTGGGCTCATCGTTATTC) and the CHIKV Probe (5’ to 3’: FAM-CGCTGTGATACAGTGGTTTCGTGTG), based on an assay previously described [11 (link)]. Thermocycler conditions consisted of reverse transcription at 45°C for 15 mins followed by RT inactivation at 95° C for 2 mins, 40 cycles of denaturation at 95°C for 15 sec and annealing at 60° C for 1min.

Goes de Jesus J., da Luz Wallau G., Lima Maia M., Xavier J., Oliveira Lima M.A., Fonseca V., Salgado de Abreu A., Fraga de Oliveira Tosta S., Ramos do Amaral H., Andrade Barbosa Lima I., Viana Silva P., Carlos dos Santos D., Sousa de Oliveira A., Campos de Souza S., Barreto Falcão M., Cerqueira E., Ceschini Machado L., Sobral M.C., Teodoro Rezende T.M., Ribeiro Pereira M., Mota Pereira F., Pereira Gusmão Maia Z., Freitas de Oliveira França R., Luiz de Abreu A., Campelo de Albuquerque e Melo C.F., Rodrigues Faria N., Venâncio da Cunha R., Giovanetti M, & Alcantara L.C. (2020). Persistence of chikungunya ECSA genotype and local outbreak in an upper medium class neighborhood in Northeast Brazil. PLoS ONE, 15(1), e0226098.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!