Gold(iii ) chloride aflatoxin B1 (Afl B1), and ochratoxin were purchased from Sigma-Aldrich. Sodium citrate and sodium chloride were procured from Sisco Research Laboratories Pvt. Ltd. (SRL), India. The aptamer sequence of Afl B1 was GTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCACA (5′ to 3′). The ssDNA oligonucleotides were synthesized by GCC biotech. Stock solutions (100 μM) of aptamers were dissolved in ultrapure water and stored at −20 °C. Whatman filter paper was purchased from GE healthcare, India. Trysulfonium hexaflurophosphate and propylene glycol monomethyl ether acetate (PGMEA) were procured from Sigma-Aldrich. All reagents were of analytical grade and used as received.
Sodium citrate
Manufactured by Sisco Research Laboratories
Sourced in India
Sodium citrate is a white, crystalline, water-soluble compound. Its core function is as a chemical compound, serving as a buffer and chelating agent. Sodium citrate is widely used in various industries, including pharmaceuticals, food, and research applications.
Automatically generated - may contain errors
Lab products found in correlation
Sodium chloride (nacl), by Sisco Research Laboratories (3 mentions)
Whatman filter paper, by GE Healthcare (2 mentions)
Trysulfonium hexaflurophosphate, by Merck Group (2 mentions)
Whatman, by Cytiva (2 mentions)
Propylene glycol monomethyl ether acetate, by Merck Group (1 mentions)
Ochratoxin, by Merck Group (1 mentions)
Trichloroacetic acid tca, by Merck Group (1 mentions)
Thiobarbituric acid, by Merck Group (1 mentions)
Sodium dodecyl sulfate (sds), by Sisco Research Laboratories (1 mentions)
Hydroxylamine hydrochloride, by HiMedia (1 mentions)
Tris hcl, by HiMedia (1 mentions)
Gold 3 chloride, by Merck Group (1 mentions)
Propyleneglycol monomethylether acetate pgmea, by Merck Group (1 mentions)
Acetonitrile, by Merck Group (1 mentions)
Acetic acid, by Merck Group (1 mentions)
Nunc elisa plates, by Thermo Fisher Scientific (1 mentions)
4 protocols using sodium citrate
1
Aptamer-based Aflatoxin B1 Detection
2
Dacarbazine Cytotoxicity Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Analytical grade dacarbazine (daczin, 200 mg) (Indon, Zydus Cadila Healthcare Ltd., Ahmedabad, India), MEM Media, Tris-HCl, Hydroxylamine hydrochloride (Hi-media Laboratories Ltd., Mumbai, India), nitroblue tetrazolium (NBT), sodium azide, ethylene diamine tetra acetic acid (EDTA), Hydrogen peroxide, Reduced glutathione, 5,5’-dithiobis (2-nitrobenzoic acid) (DTNB), Sodium citrate, Sodium dodecyl sulfate (Sisco Research Laboratory, India), thiobarbituric acid (TBA) and trichloroacetic acid (TCA) (Merck India Ltd, Mumbai, India) were used for study.
3
Aptamer-based Detection of Mycotoxins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gold (III) chloride and Aflatoxin M1 (Afl M1) were purchased from Sigma-Aldrich. Sodium citrate and sodium chloride were procured from Sisco Research Laboratories Pvt. Ltd. (SRL), India. The 21-mer aptamer sequence of Afl M1 (ACTGCTAGAGATTTTCCACAT (5′ to 3′)), The Ochratoxin aptamer sequence used was 36-mer 5-GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACA-3 and the ssDNA oligonucleotides were synthesized by GCC biotech, India. Stock solutions (100 μM) of aptamers were dissolved in ultrapure water then stored at −20 °C. Whatman filter paper was purchased from GE healthcare, India. Trysulfonium hexaflurophosphate and Propylene glycol monomethyl ether acetate (PGMEA) were procured from Sigma-Aldrich. All reagents were of analytical grade and used as received.
4
Aptamer-based Detection of Mycotoxins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gold chloride (HAuCl4), Aflatoxin B1, OTA, trysulfonium hexafluorophosphate salt, propylene glycol monomethyl ether acetate, and negative photoresist were purchased from Merck, Delhi, India. Sodium citrate and sodium chloride were purchased from Sisco Research Laboratories Pvt. Ltd, Delhi, India. The 36-mer aptamer sequence of OTA was 5′-GATCGGGTGTGGGTGGCGTAAAGGGAGCATCGGACA-3′, and 21-mer aptamer sequence of aflatoxin B1 5′-GTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCG CTAGGCCCACA-(3′) was purchased from GCC Biotech (India) Pvt. Ltd, Kolkata, India. Nunc Elisa plates were purchased from ThermoFisher Scientific, Delhi, India. Corn and groundnut samples were purchased from a local supermarket in Hyderabad, India. For HPLC analysis, acetonitrile, water, and acetic acid were purchased at a high purity grade from Merck, Delhi, India. All reagents used for the experiments were of analytical grade.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!