Rpmi 1640 medium

Human UM cell lines MUM-2B and C918 were purchased from Chinese Academy of Sciences Cell Bank (Shanghai, China) and cultured in RPMI 1640 medium (KeyGene, Nanjing, China) with 10% fetal bovine serum (FBS; HyClone, Logan, UT, USA) and 50 µg/mL penicillin/streptomycin in humidified air at 37°C with 5% CO₂. Human melanocytes (D78) obtained from Chinese Academy of Sciences Cell Bank were culture in Dulbecco’s modified Eagle’s medium (DMEM; KeyGene).
The GAS5 sequence was synthesized according to the full-length GAS5 sequence and then sub-cloned into a pcDNA3.1 vector (Invitrogen, Shanghai, China). GAS5 siRNAs negative control siRNA (si-NC) were specifically synthesized by Shanghai GenePharma Co, Ltd. (Shanghai, China). The sequences of the GAS5 siRNAs were as follows: si-GAS5 (#1), AGTGTGGCTCTGGATAGCACCTTAT; si-GAS5 (#2), AGGAAGGATGAGAATAGCTACTGAA; si-GAS5 (#3), CAGTGTGGCTCTGGATAGCACCTTA. miR-21 mimics and mimics negative control were purchased from Genecopoeia (Guangzhou, China). Cells at 70~80% confluence were selected for transfection using Lipofectamine 2000 reagent (Invitrogen). Forty-eight hours after transfection, the cells were collected for further analysis.

Five GC cell lines (AGS, HGC-27, BGC-823, MGC-803, and SGC-7901) and normal human gastric mucosa cells GES-1, purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China), were culture in RPMI 1640 medium (KeyGene, Nanjing, China) containing 10% foetal bovine serum (FBS; Invitrogen, Carlsbad, CA, USA) in a 37°C humidified atmosphere of 5% CO₂.
Human miR-186 mimics, miR-186 inhibitor, and mimics/inhibitor control were purchased from GenePharma (Shanghai, China), and their sequences were listed in Table II. Knockdown of OIP5-AS1 in cells was obtained by transfection with shRNAs. Chemically synthesised siRNA sequence targeting OIP5-AS1 and the control sequence were inserted into to the shRNA expression vector pGPH1/Neo (GenePharma). The sequences of sh-OIP5-AS1 were sense: 5’-CACCGCTCCTAGGATTCCAGTTATCCGAAGATAACTGGAATCCTAGGAGC-3’; antisense: 5’-AAAAGCTCCTAGGATTCCAGTTATCTTCGGATAACTGGAATCCTAGGAGC-3’. Cell transfection was performed using Lipofectamine 3000 (Invitrogen) following the manufacturer’s protocol.

The human LUAD cell line H1975 was purchased from Shanghai Institute of Life Sciences (Shanghai, China). The cells were cultured in RPMI 1640 medium (KeyGene, Nanjing, China), containing 10% fetal bovine serum (FBS) and penicillin/streptomycin (KeyGene, Nanjing, China) in a humidified environment with 5% CO2 at 37 °C. Cells were seeded in 6-well plates before transfection. When the fusion rate reaches 60%-70%, use Lipofectamine 3000 reagent (Invitrogen, California, USA) to transfect MiRNA mimic (10nM, 50nM) and negative control into the cells. The miRNA mimics and mimic negative control were purchased from RiboBio (Guangzhou, China). Transfection efficiency was assessed by quantitative real-time RT-PCR.

The LUAD cell lines (A549, PC9, NCI‐H1299, SPC‐A1, and NCI‐H1975), DDP‐resistant A549 (A549/DDP), and human bronchial epithelial (HBE) cells were purchased from Shanghai Institutes for Biological Science (Shanghai, China). DMEM or RPMI‐1640 medium (KeyGene, Nanjing, Jiangsu, China), which was supplemented with 10% fetal bovine serum (FBS, Gibco, Carlsbad, CA, USA), was used to culture cells. All cells were grown in an incubator at 37°C in 5% CO₂. We routinely detected of mycoplasma contamination. All cell lines were authenticated.