SRV genome in culture medium was extracted by viral RNA extraction kit (TIANGEN) and reverse transcripted into cDNA by a reverse transcriptase PCR kit (TaKaRa). Cellular genome was extracted by a TIANamp Genomic DNA Kit (TaKaRa). Real-time PCR was performed in a 7500 Fast Real-Time PCR System (Applied Biosystems) by using a Premix Ex Taq (Probe qPCR) kit (TaKaRa). SRV genome positive control, primers, and probe, as well as GAPDH primers and probe were kindly provided by VRL China Ltd. [51 (link)].
Reverse transcriptase pcr kit
Manufactured by Takara Bio
Sourced in China, Japan
The Reverse Transcriptase PCR (RT-PCR) kit is a laboratory tool used for the detection and quantification of RNA molecules. It combines the processes of reverse transcription and polymerase chain reaction (PCR) to amplify and analyze specific RNA targets.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Takara Bio (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Tianamp genomic dna kit, by Takara Bio (1 mentions)
Viral rna extraction kit, by Tiangen Biotech (1 mentions)
Premix ex taq probe qpcr kit, by Takara Bio (1 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Primer express software version 2, by Thermo Fisher Scientific (1 mentions)
Gel doc 1000 imaging system, by Bio-Rad (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Sybr green qpcr supermix, by Bio-Rad (1 mentions)
6 protocols using reverse transcriptase pcr kit
1
Quantitative SRV Genome Detection
2
Quantifying lncRNA Expression with qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRIzol®reagent (Takara Biotechnology Co., China), and the cDNA samples were synthesized using random primers and a Reverse Transcriptase PCR kit (Takara Biotechnology Co, China). The expressions of lncRNA SSR3-6, WISP1-2, CYP4F22-3 and UBAC2-6 were quantified by real-time PCR. GAPDH was used as the internal control.
The SSR3-6 primers:
The SSR3-6 primers:
3
Gene Expression Analysis of Cadmium-Treated Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from untreated and Cd-treated CNE-1 and CNE-2 cells using TRIzol (Invitrogen, Grand Island, NY, USA) and cDNA was prepared using reverse transcriptase PCR kit (Takara, Shiga, Japan). RT-PCR was conducted as previously described37 (link) using primers designed with Primer Express Software version 2.0 (Applied Biosystems, Forster City, Canada): cyclin D1 forward 5-TGTCCTACTACCGCCT CACA-3 and reverse 5-CAGGGCTTCGATCTGCTC-3; cyclin E forward 5-AAAAGGTTTCAGGGTATCAG-3 and reverse 5-TGTGGGTCTGTATGTTGTG-3; c-myc forward 5-GCCCCTCAACGTTAGCTTCA-3 and reverse 5-TTCCAGATATCCTCGCTGGG-3; c-jun forward 5-AAGAACTCGGACCTCCTCAC-3 and reverse 5-CTCCTGCTCATCTGTCACG-3; β-actin forward 5-AGCGAGCATCCCCCAAAGTT-3 and reverse 5-GGGCACGAAGGCTCATCATT-3. Gene expression relative to β-actin was determined by the comparative CT method (2−ΔΔCT). All experiments were performed in triplicate.
4
Semi-Quantitative PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.), and cDNA samples were synthesized using random primers and a Reverse Transcriptase PCR kit (Takara Bio, Inc.) according to the manufacturer's protocols. cDNA was used as a template for semi-quantitative PCR. The thermocycling conditions were as follows: 94°C for 5 min, 94°C for 30 sec, 68°C for 30 sec and 72°C for 12 cycles with a decrease in 1°C/cycle; then, 94°C for 30 sec, 55°C for 30 sec, and 72°C for 30 sec for 18-27 cycles depending on the abundance of the target genes. The PCR products were identified by electrophoresis using 1.5% agarose gels. GAPDH was used as an internal reference control. The results were recorded using Gel Doc 1000 imaging system and Quantity One version 4.5.0 software (Bio-Rad Laboratories, Inc.). The primers used in this study are shown in Table I .
5
Quantifying NUSAP1 and TGF-beta Receptor 1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cell lines and tissues with TRIzol® reagent (Takara Biotechnology Co., Ltd., China), and cDNA samples were synthesized using random primers and a Reverse Transcriptase PCR kit (Takara Biotechnology Co., Ltd., China) according to the manufacturer’s protocols. NUSAP1 mRNA expression and its correlation with TGF-beta receptor 1 expression were assessed by real-time PCR. β-actin expression was used as the internal control. The following primers were used: human NUSAP1, forward, 5ʹ-CGTCCCCTCAACTATGAACCAC-3ʹ, reverse, 5ʹ-GCGTTTCTTCCGTTGCTCTT-3ʹ; β-actin, forward, 5ʹ-CCACGAAACTACCTTCAACTCC-3ʹ, reverse, 5ʹ-GTGATCTCCTTCTGCATCCTGT-3ʹ; TGFBR1, forward, 5ʹ-ACATGATTCAGCCACAGATACC-3ʹ, reverse, 5ʹ-GCATAGATGTCAGCACGTTTG-3ʹ.
6
Quantitative Analysis of β-Catenin Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cells using TRIzol (Invitrogen, Grand Island, NY, United States) and reversely transcribed using a reverse transcriptase PCR kit (Takara, Shiga, Japan). qPCR was performed using SYBR Green qPCR SuperMix (Bio-Rad, California, United States) and an ABI 7500 Fast Sequence Detection system (ABI, Foster, United States). The following primers were used for qPCR analysis for β-catenin signaling: cyclin D1 forward 5-TGTCCTACTACCGCCTCACA-3 and reverse 5-CAGGGCTTCGATCTGCTC-3; cyclin E forward 5-AAAAGGTTTCAGGGTATCAG-3 and reverse 5- TGTGGGTCTGTATGTTGTG-3; c-myc forward 5-GCCCCTCAACGTTAGCTTCA -3 and reverse 5- TTCCAGATATCCTCGCTGGG-3; c-jun forward 5-AAGAACTCGGACCTCCTCAC-3 and reverse 5- CTCCTGCTCATCTGTCACG-3; β-actin forward 5- AGCGAGCATCCCCCAAAGTT -3 and reverse 5-GGGCACGAAGGCTCATCATT-3. Gene expression relative to β-actin was determined by the comparative CT method (2−ΔΔCT). All experiments were performed in triplicate.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!