Probe preparation. ucn337 (link) cDNA was PCR amplified using primers with an Sp6-promoter sequence and a T7-promoter sequence, respectively, tagged onto the 5′-end (ucn3l-fw: 5′- ATTTAGGTGACACTATAGtctctctcgcctccgttctccaa-3′; ucn3l-rv: 5′-TAATACGACTCACTATAGggagatcaaattggtgacacgaacaca-3′). DIG RNA labeling mix (Roche) was used to generate DIG-labeled ucn3l probes by in vitro transcription with T7 RNA polymerase (Fermentas). RNA probes were purified using Micro Bio-Spin30 Columns, Tris, RNase-free (Bio-Rad). For the insulin probe, cDNA from 24 hpf embryos was PCR amplified using the following primers: insa-fw: 5′-atggcagtgtggcttcaggc-3′; insa-rv: 5′-gaattctcagttacagtagt-3′. PCR products of the correct size were purified from agarose gels using the QIAquick Gel Extraction Kit (QIAGEN), and subcloned using the Dual Promoter TA Cloning kit (Invitrogen). Plasmids were linearized using the appropriate enzyme and fluorescein-labeled probes were generated by in vitro transcription using T7 RNA polymerase (Fermentas).
T7 rna polymerase
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany, Canada
The T7 RNA polymerase is an enzyme that catalyzes the transcription of DNA into RNA. It is derived from the bacteriophage T7 and recognizes the T7 promoter sequence to initiate RNA synthesis.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (21 mentions)
Dnase 1, by Thermo Fisher Scientific (17 mentions)
Rneasy plus mini kit, by Qiagen (13 mentions)
Biotin rna labeling mix, by Roche (12 mentions)
Rnase inhibitor, by Thermo Fisher Scientific (12 mentions)
Dnase 1, by Qiagen (11 mentions)
Rnase free dnase 1, by Thermo Fisher Scientific (9 mentions)
Dig rna labeling mix, by Roche (9 mentions)
Biotin rna labeling mix, by Thermo Fisher Scientific (7 mentions)
Ribolock rnase inhibitor, by Thermo Fisher Scientific (7 mentions)
Inorganic pyrophosphatase, by Thermo Fisher Scientific (7 mentions)
Transcription buffer, by Thermo Fisher Scientific (6 mentions)
Biotin rna labeling mixture, by Thermo Fisher Scientific (5 mentions)
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (5 mentions)
Biotin rna labeling mix, by Merck Group (5 mentions)
Streptavidin magnetic beads, by Merck Group (5 mentions)
Trizol, by Thermo Fisher Scientific (5 mentions)
Rq1 dnase, by Promega (5 mentions)
Cell lysis buffer, by Merck Group (4 mentions)
283 protocols using t7 rna polymerase
1
Preparation of DIG-labeled RNA Probes for in situ Hybridization
Check if the same lab product or an alternative is used in the 5 most similar protocols
Probe preparation. ucn337 (link) cDNA was PCR amplified using primers with an Sp6-promoter sequence and a T7-promoter sequence, respectively, tagged onto the 5′-end (ucn3l-fw: 5′- ATTTAGGTGACACTATAGtctctctcgcctccgttctccaa-3′; ucn3l-rv: 5′-TAATACGACTCACTATAGggagatcaaattggtgacacgaacaca-3′). DIG RNA labeling mix (Roche) was used to generate DIG-labeled ucn3l probes by in vitro transcription with T7 RNA polymerase (Fermentas). RNA probes were purified using Micro Bio-Spin30 Columns, Tris, RNase-free (Bio-Rad). For the insulin probe, cDNA from 24 hpf embryos was PCR amplified using the following primers: insa-fw: 5′-atggcagtgtggcttcaggc-3′; insa-rv: 5′-gaattctcagttacagtagt-3′. PCR products of the correct size were purified from agarose gels using the QIAquick Gel Extraction Kit (QIAGEN), and subcloned using the Dual Promoter TA Cloning kit (Invitrogen). Plasmids were linearized using the appropriate enzyme and fluorescein-labeled probes were generated by in vitro transcription using T7 RNA polymerase (Fermentas).
+ Expand
Probe preparation. ucn337 (link) cDNA was PCR amplified using primers with an Sp6-promoter sequence and a T7-promoter sequence, respectively, tagged onto the 5′-end (ucn3l-fw: 5′- ATTTAGGTGACACTATAGtctctctcgcctccgttctccaa-3′; ucn3l-rv: 5′-TAATACGACTCACTATAGggagatcaaattggtgacacgaacaca-3′). DIG RNA labeling mix (Roche) was used to generate DIG-labeled ucn3l probes by in vitro transcription with T7 RNA polymerase (Fermentas). RNA probes were purified using Micro Bio-Spin30 Columns, Tris, RNase-free (Bio-Rad). For the insulin probe, cDNA from 24 hpf embryos was PCR amplified using the following primers: insa-fw: 5′-atggcagtgtggcttcaggc-3′; insa-rv: 5′-gaattctcagttacagtagt-3′. PCR products of the correct size were purified from agarose gels using the QIAquick Gel Extraction Kit (QIAGEN), and subcloned using the Dual Promoter TA Cloning kit (Invitrogen). Plasmids were linearized using the appropriate enzyme and fluorescein-labeled probes were generated by in vitro transcription using T7 RNA polymerase (Fermentas).
2
Preparation of Positive and Negative Sense RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Both (+) and (−) sense 5′-end RNA sequences were prepared from the pT1P1-5′3′-UTR-II plasmid. In preparation of the (+) sense 5′-end RNA sequence, the plasmid was linearized by NdeI and transcribed with T7 RNA polymerase using an in vitro transcription system (Fermentas). The RNA products (599 bp) were extracted with phenol-chloroform, precipitated in ethanol, and then stored in a deep freezer until used for transfection. To prepare the (−) sense 5′-end RNA sequence, the plasmid was first linearized, and the 3′-end sequence of the subgenomic DNA was deleted with NdeI. The resultant linear forms of the plasmid were religated and then redigested with SacII. The products were transcribed with T7 RNA polymerase using an in vitro transcription system (Fermentas) to generate the (−) sense 5′-end RNA sequence which was harvested as done for the (+) sense 5′-end RNA sequence. To prepare dsRNA, positive- and negative-stranded RNA described from pT1P1-5′3′-UTR-II were mixed together, incubated at 95°C for 5 min and then 4°C for 10 min. Ultimately, 2 μL RNase was added to cleave single-stranded RNA that failed to anneal in the mixture. The product was used to evaluate degradation of dsRNA fragments in host cells.
3
In Vitro Transcription and Protein Pulldown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
WT PCAT1 was transcribed in vitro with biotin RNA labeling
mixture and T7 RNA polymerase according to the manufacturer’s instructions
(Invitrogen). MUT PCAT1 transcripts were transcribed in vitrowith biotin RNA labeling mixture and T7 RNA polymerase with nested PCR.
Streptavidin-linked magnetic beads (400 μl; Thermo Fisher Scientific, Waltham,
MA, USA) were used to pull down the biotinylated transcripts for 2 h at room
temperature. Then, the beads-RNA-proteins were washed with 1× binding washing
buffer (5 mM Tris-hydrochloric acid, 1 M NaCl, 0.5 mM EDTA, and 0.005% Tween 20)
for 4r times. The proteins were precipitated and diluted in protein lysis buffer
(500 μl). Eventually, the retrieved proteins were measured on SDS-PAGE gels for
Western blotting.
mixture and T7 RNA polymerase according to the manufacturer’s instructions
(Invitrogen). MUT PCAT1 transcripts were transcribed in vitrowith biotin RNA labeling mixture and T7 RNA polymerase with nested PCR.
Streptavidin-linked magnetic beads (400 μl; Thermo Fisher Scientific, Waltham,
MA, USA) were used to pull down the biotinylated transcripts for 2 h at room
temperature. Then, the beads-RNA-proteins were washed with 1× binding washing
buffer (5 mM Tris-hydrochloric acid, 1 M NaCl, 0.5 mM EDTA, and 0.005% Tween 20)
for 4r times. The proteins were precipitated and diluted in protein lysis buffer
(500 μl). Eventually, the retrieved proteins were measured on SDS-PAGE gels for
Western blotting.
4
In Vitro Transcription of sgRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
T7::sgRNA expression cassettes were amplified from their respective pJET1.2 host vectors using primers listed in Additional file 1 : Table S3. One microgram of gel-purified linear DNA was used as a template in an in vitro transcription reaction using 100 U of T7 RNA Polymerase (EP0111, Thermo Fisher), 0.1 U inorganic pyrophosphatase (EF0221, Thermo Fisher), 40 U RiboLock RNase Inhibitor (EO0381, Thermo Fisher), and 10 mM NTP mix (R0481, Thermo Fisher) in 1× T7 RNA Polymerase buffer for 16 h at 37 °C. Transcribed sgRNAs were purified by phenol - chloroform extraction.
5
In Vitro Transcription of PCR Products
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The crude PCR products were used as templates for in vitro transcription using the T7 polymerase system. The IVT reaction mixture contained 400 μL PCR product (without further purification), 5 mM of each NTP, 5 mM DTT, 2.5 μg mL−1 BSA, MgCl2 (concentration depends on RNA type and was determined before using micro reactions with different MgCl2 concentrations), 50 U mL−1 T7 RNA polymerase (ThermoFisher) and 1× reaction buffer (ThermoFisher) in a final volume of 1 mL. The reaction was incubated at 37 °C for 2 hours, and then, another aliquot of T7 RNA polymerase was added and incubated for 4 hours at 37 °C.
6
Molecular Biology Reagents and Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Deoxyribonucleoside triphosphates (dNTPs), Taq DNA polymerase with 10 × ThermoPol buffer, MgSO4, GC enhancer, Q5 High-Fidelity DNA polymerase with 5 × Q5 reaction buffer, RNase inhibitor, Cas9 Nuclease (S. pyogenes) with NEBuffer r3.1, Proteinase K, Monarch DNA Gel Extraction Kit, and the Monarch Plasmid DNA Miniprep Kit were purchased from New England Biolabs. The SYBR Gold Nucleic Acid Gel Stain, Turbo DNase I, guanosine 5′-monophosphate (GMP), T4 RNA ligase with 10 × reaction buffer, and CloneJet PCR cloning kit were obtained from ThermoFisher Scientific. T7 RNA polymerases were purchased either from New England Biolabs (T7 RNA polymerase and HiScribe T7 High Yield RNA Synthesis Kit) or ThermoFisher Scientific (T7 RNA polymerase with 5× Transcription Buffer). pCp-Cy5 dye was purchased from Jena Bioscience. Gel filtration columns, illustra NAP-25, were acquired from Cytiva. All unmodified oligodeoxyribonucleotides were purchased from Integrated DNA Technologies (IDT, Leuven). All other chemicals were obtained either from VWR or Sigma-Aldrich.
7
Cell-Free Protein Synthesis Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The complete total reaction mix was 30 μl, which contained 55 mM Hepes-KOH pH 7.5, 4% polyethylene glycol (PEG) 8000, 210 mM potassium glutamate, 1.8 mM DTT, 1.2 mM ATP, 0.8 mM each of CTP, GTP, UTP, 0.64 mM 3’, 5’-cyclic AMP, 35 μg/ml folinic acid, 27.5 mM ammonium acetate, 80 mM creatine phosphate, 0.25 mg/ml creatine kinase, 175 μg/ml Escherichia coli total tRNA, 0.05% sodium azide, 10.7mM magnesium acetate, 1 mM each amino acid, 0.5 mM methionine, 0.5μl of 35S labelled methionine (1 mCi/ml)–from Amersham Bioscience, Little Chalfont, UK, 0.27 μl T7 RNA polymerase (200 U/μl, Ambion, Huntingdon, UK), 7.2 μl S30 extract and 60 to 250 ng of DNA template. The reactions were incubated within a polypropylene 96-well plate (Anachem, Luton, UK) in a Dyad DNA Engine thermo cycler (MJ Instruments, UK) for 90 minutes.
8
In Situ Hybridization of Drosophila Ovaries
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ovaries were dissected and fixed in 4% formaldehyde in PBS for 20 min and postfixed in 4% formaldehyde in PBS + 0.1% Tween-80 (PBTw). Samples were washed three times in PBTw for 2 min and then incubated in 3 µg/ml proteinase K in PBTw for 10 min at room temperature followed by 30 min on ice. Digestion was quenched by incubation in 2 µg/ml glycine/PBTw for 2 min twice. After two PBTw rinses, ovaries were postfixed for 20 min in 4% formaldehyde. Ovaries were washed five times in PBTw (Lécuyer et al., 2008 (link)). Samples were then hybridized to the indicated probe as previously described (Tomancak et al., 2002 (link)). Detection was performed with 1:200 peroxidase-conjugated anti-DIG (Roche) and 1:100 Cy5 tyramide reagent (PerkinElmer).
Fluorescent in situ probes were synthesized by in vitro transcription from vector template DNA that was linearized by digestion with ApaI for H3-coding and XhoI for H3-ds as previously described (Lanzotti et al., 2002 (link)). The H3 coding probe was transcribed with T3 RNA polymerase (Ambion), and the H3-ds probe was transcribed with T7 RNA polymerase (Ambion) using the DIG RNA labeling mix (Roche). RNA synthesis was verified by agarose gel electrophoresis. The sequence boundaries for each probe are summarized inTable 7 .
Fluorescent in situ probes were synthesized by in vitro transcription from vector template DNA that was linearized by digestion with ApaI for H3-coding and XhoI for H3-ds as previously described (Lanzotti et al., 2002 (link)). The H3 coding probe was transcribed with T3 RNA polymerase (Ambion), and the H3-ds probe was transcribed with T7 RNA polymerase (Ambion) using the DIG RNA labeling mix (Roche). RNA synthesis was verified by agarose gel electrophoresis. The sequence boundaries for each probe are summarized in
9
Genetic manipulation of PpV in Drosophila
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the PpV rescue construct, a 2679 bp EcoRI fragment from BAC clone 18C-18 (BACPAC Resources Center) was isolated and cloned into the pattB vector (Bischof et al. 2007 (link)). For GFP-PpV, the 5′ terminal 444 bp (a HindIII/EcoRI-BspM1 fragment) was replaced by a corresponding 1229 bp fragment with codon optimized GFP and a linker inserted at the start codon, which was synthesized by Eurofins Genomics and cloned into the pattB vector. CS2-tribbles plasmid template was linearized by XhoI and transcribed by SP6 Transcription Kit (Ambion) (Grosshans and Wieschaus 2000 (link)). dsRNAs were produced by T7 RNA polymerase (Ambion), NTPs, RNase inhibitor (Thermo Fisher) and Pyrophosphatase (Thermo Fisher), using CS2-tribbles as template and dsRNA primers BL10 (GTAATACGACTCACTATAGGGCGATCAGCGCACAGCCTAGTCA) and BL11 (GTAATACGACTCACTATAGGGCGATGGCCATAGATGGTGCTCC) (Farrell and O’Farrell 2013 (link)).
10
Generation of Double-Stranded RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate dsRNA for each gene, two pairs of primers (without and with T7 promoter extension: TAATACGACTCACTATAGGGAGA ) were used to generate PCR product template (S2 Table ). Equal amounts of sense and antisense template strands were mixed before dsRNA synthesis. dsRNA synthesis was performed with T7 RNA Polymerase from MEGAscript® RNAiKit (Ambion Inc.) according to manufacturer instructions. Final concentration of dsRNA was measured with spectrometry (NanoDrop Technologies Inc.) and adjusted to 1.5 μg/μl.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!