Jetpei transfection reagent

Human embryonic kidney HEK-293T cells were cultured in Dulbecco's modified Eagle medium (Gibco) supplemented with 10% fetal bovine serum (FBS) (Gibco). One day before the transfection, 0.5–1 × 10⁵ HEK-293T cells per well were grown in a 24-well culture plate with 1 ml complete medium for 18 h. The medium was then replaced by 1% FBS of MEM for 1 h before the adding of the mixture of 0.5 μg plasmid DNA and jetPEI^TM transfection reagent (Polyplus) into each well according to the manufacturer's instructions. The 1% FBS-MEM containing theophylline (Sigma) or Adox (Sigma) was added 4 h after the transfection and cells were grown for 20 h before further analysis. To perform the MTT assay, thiazolyl blue tetrozolium Bromide (MTT, Sigma) was added to final concentration of 0.5 mg/ml and then incubated 3 h for crystal formation. The crystals were then dissolved by Dimethyl sulfoxide (DMSO) and measured for absorbance at 550 nm by enzyme-linked immunosorbent assay reader (TECAN). The results were then presented as cell viability by comparing with that of the non-treated 293T cells.

NIH3T3 cells (mycoplasma free) were grown in Dulbecco’s modified Eagle’s medium containing 10% fetal calf serum (Biological Industries, Israel). The cells were stably transfected with the following plasmids (6 μg): pcDNA3 as control; Vav1, oncVav1, E59K, D517E, and L801P using the jetPEI^® transfection reagent (PolyPlus, CA) according to the manufacturer’s instructions. Stable clones were selected using 0.5 mg/ml G418 and were verified by sequencing. We further applied limiting dilution to all stable clones by seeding one cell per well in 96-well plates and selected two subclones for each mutation. For caspase inhibition, the cells were treated with 50 μM zVAD, a caspase inhibitor overnight.

COS7 cells were obtained from the ATCC (Manassas, VA) and maintained at 37°C under 5% CO₂ in Dulbecco’s Modified Eagle Medium (HyClone, supplemented with 10% heat-inactivated CCS, 100 U/mL penicillin and 100 μg/mL streptomycin). Cells were plated at ~3x10⁵ cells onto 25 mm round No. 1.5 coverslips (Fisherbrand) and transfected with jetPEI transfection reagent (Polyplus Transfection, Strasbourg, France) according to the manufacturers recommendations. Media was replaced 16 hours after transfection and cells were imaged 24 hours after transfection. In experiments with Gag fusion proteins, cells were fixed with 4% paraformaldehyde for 10 min prior to imaging.

To generate DLD-1 and HCT116 XPC KO cells transiently expressing XPC-GFP, cells were transfected with an XPC-GFP cDNA construct (pLenti-CMV-Puro-DEST; (43 (link))) using jetPEI® transfection reagent (Polyplus) following the producer's protocol. To generate GFP-DDB2 HCT116 KI cells, cells were transfected with pLentiCRISPR-v2 carrying an sgRNA targeting the start codon of the DDB2 locus (target sequence CCTTCACACGGAGGACGCGA), and a DNA construct of GFP flanked by 60 bp sequences homologous to the DDB2 locus. After selection with puromycin and FACS for GFP-positive cells, a clonal cell line was isolated and verified by sequencing and functional analysis.

Plasmid construction and the production of recombinant lentiviruses doubly expressing reporter copGFP and hepatocyte nuclear factor (HNF)-1α or (HNF)-1β, sex determining region Y-box 17 (SOX17), X-box-binding protein 1 (XBP-1), pregnane X receptor (PXR), or retinoid X receptor (RXR) were obtained as described previously [19] (link). In brief, the cDNA was subcloned into pCDH cDNA Expression Lentivector (System Biosciences, Mountain View, CA, USA) under control of a CMV promoter. A separate promoter EF1 would constitutively promote the expression of the reporter copGFP. To produce recombinant lentiviruses, HEK293T cells were co-transfected with respective recombinant expression lentivectors in combination with envelop plasmid pMD2.G and packaging plasmid psPAX2 (deposited to Addgene, Cambridge, MA, by Dr. Didier Trono, School of Life Sciences and Frontiers in Genetics Program, Lausanne, Switzerland) using jetPEI transfection reagent (Polyplus-Transfection Inc., New York, NY, USA). The control virus was produced using the cloning vector without insertion.