Male C57BL6J wild-type (WT, n = 16; Stock 000664) and Nlrp3 knockout (Nlrp3-/-, n = 16; B6.129S6-Nlrp3/J; Stock 021302) mice on a C57BL6J background were purchased from Jackson Laboratory (Bar Harbor, ME). WT and Nlrp3-/- mice were not littermates. At 5 weeks of age, mice were randomized to either a control diet or Western diet (n = 8/group) ad libitum for 24 weeks. Control diet (3.85 kcal/g of food) contained 10% kcal fat, 70% kcal carbohydrate, and 20% kcal protein, with 3.5% kcal sucrose (D12110704; Research Diets Inc.). Western diet (4.68 kcal/g of food) contained 44.9% kcal fat, 35.1% kcal carbohydrate, and 20% kcal protein, with 1% cholesterol and 17% kcal sucrose (D09071604; Research Diets Inc.). All mice were pair-housed and kept at 25°C with a light cycle from 0700 to 1900 and a dark cycle from 1900 to 0700 under conventional (i.e., non-specific pathogen free) animal housing facilities. At 29 weeks of age, mice were euthanized via CO2 inhalation following a 5-hour fast. Samples were harvested and stored at -80°C until analysis. Male mice were used in this study because they are more susceptible to Western diet-induced AT inflammation [14 (link)]. All procedures were approved in advance by the University of Missouri Institutional Animal Care and Use Committee.
Stock 000664
Manufactured by Jackson ImmunoResearch
Sourced in United States
Stock 000664 is a laboratory reagent produced by Jackson ImmunoResearch. It serves as a purified preparation of immunoglobulin G (IgG) from normal goat serum.
Automatically generated - may contain errors
Lab products found in correlation
10 protocols using stock 000664
1
Investigating NLRP3 in Diet-Induced Inflammation
2
Bone Marrow Macrophage Activation Assay
3
Autophagic Flux Analysis in Transgenic Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mice used throughout this study were on a C57BL/6J background. Wild-type mice were obtained from The Jackson Laboratories (Stock 000664). The use of mice complied with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research, and all procedures were reviewed and approved by the Institutional Animal Care and Use Committee of the VA Western NY Healthcare System (VAWNYHS). A validated, established CAG-RFP-EGFP-LC3 transgenic mouse line is currently available through JAX laboratories (C57BL/6-Tg[CAG-RFP/GFP/Map1lc3b]1Hill/J). However, the CAG-RFP-EGFP-LC3 mouse line used in this study was a kind gift from Dr. Joseph Hill (Department of Cardiology, University of Texas Southwestern Medical School, Dallas, TX). CAG-RFP-GFP-LC3 mice were maintained under the standard 12 h:12 h cyclic light-dark regimen (standard white fluorescent lighting; 20–40 lux ambient light intensity). Transgenic mice were selected by PCR tail snip analysis using the following primer sets: FWD: 5ʹ – CATGGACGAGCTGTACAAGT – 3ʹ, and REV: 5ʹ – CACCGTGATCAGGTACAAGGA – 3ʹ, which yields a 208-bp product [17 (link)]. Two- to Four-month old transgenic mice were sacrificed for analysis of autophagic flux. NRL-EGFP and abca4−/- mouse eyes were kind gifts of Dr. Anand Swaroop (National Eye Institute/NIH, USA), and Dr. Muna I. Naash (University of Houston, USA).
4
C57BL/6J Mice Care Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Experiments were performed on a total 11 adult male C57BL/6J (B6) mice, (> 8 weeks old, 18–25 g body weight). Mice were housed in a breeding colony with 12-hour light/dark cycles in standard cages with ad libitum access to food and water. All experiments were performed during the light cycle, between 12:00 noon and 17:00 hours. None of the mice had undergone any previous experimental procedure. All animal experimental procedures adhered to guidelines approved by the University of Tennessee Health Science Center Animal Care and Use Committee. Principles of laboratory animal care (NIH publication No. 86–23, rev. 1996) were followed. Founder animals were originally purchased at Jackson Labs (Stock # 000664).
5
Intravital Imaging of Tumor-Infiltrating Immune Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Experiments were approved by the MGH Institutional Animal Care and Use Committee (IACUC) and were performed in accordance with MGH IACUC regulations (2013N000157). IL-12p40-eYFP mice (N = 6) were used for primary myeloid cell harvesting and IL-12 induction experiments as well as intravital imaging (N=4). Female C57BL/6J mice (N = 4) were utilized for MC38 tumor imaging studies by intravital microscopy. All mice were either bred IL-12 or obtained from Jackson Laboratory (Stock# 000664) and housed under specific pathogen-free conditions at the Massachusetts General Hospital.
6
C57BL/6J Mice Care Protocol
7
Aging Study in C57BL/6J Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6J male mice were ordered from Jackson Laboratories (Stock 000664; Bar Harbor, ME) at 12 wk of age and studied at 20 wk of age. Mice were group-housed at room temperature under a 12:12-h light:dark cycle and allowed ad libitum access to food and water. The Pennington Biomedical Research Center has an AALAC-approved Comparative Biology Core facility and veterinary staff that monitor the health of the animals via a sentinel program and daily inspection. All studies were approved by the Institutional Animal Care and Use Committee.
8
miR-145 Transgenic Mouse Generation
9
Mouse Model for Ophthalmic Research
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All experiments were performed at the University of Iowa, conducted in accordance with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research, and approved by the Institutional Animal Care Use and Committee of the University of Iowa. C57BL/6J mice were obtained from The Jackson Laboratory (Stock 000,664; Bar Harbor, ME) and subsequently bred and housed at the University of Iowa Research Animal Facility.
10
Bone Marrow Macrophage Activation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bone marrow from C57BL/6J mice (Stock 000664; Jackson Laboratory, Bar Harbor, ME, USA) was harvested from long bones, depleted of red blood cells, and differentiated for 6 days in Dulbecco’s Modified Eagle Medium media supplemented with penicillin–streptomycin and L929-conditioned media (20%) as previously described [23 (link)]. All bone marrow differentiation media was tested to ensure that a population of CD11b-positive (>95%) bone marrow derived macrophages (BMDMs) was present after 6 days. On Day 6, BMDMs were plated into 96-well plates (5 × 104 cells/well). The following day, the cells were infected with mycobacterial strains expressing Ag85-SIIN or 1 µg/mL of SIINFEKL peptide (Anaspec, Fremont, CA) was added as a positive control. CD8+ T cells were purified from OT-1 mice (Stock 004175; Taconic Biosciences Inc., Germantown, NY) via a cell separation method (MACS columns; Miltenyi Biotec, Auburn, CA) and added at a ratio of 5:1 OT-1 CD8+ T cells to BMDMs after 3 h of bacterial infection. The supernatant was collected after 24 h postaddition of the T cells and assayed for IL-2 and IFNγ via ELISA.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!