Macaque infection was confirmed by SIVgag nested PCR on PBMC as described [49 (link)]. Plasma samples were obtained from EDTA-treated whole blood and used for the determination of plasma VL by SIVgag qRT-PCR [50 (link)] (quantitative Molecular Diagnostics Core, AIDS and Cancer Virus Program Frederick National Laboratory). DNA and RNA were extracted from snap frozen tissues using DNeasy/RNeasy blood and tissue kits (Qiagen) following the manufacturer’s instructions. Tissue viral DNA loads were quantified using the standard curve method and normalized by albumin copy numbers by Gag-qPCR as described in [59 (link)]. For tissue RNA loads, 1μg of total RNA was retrotranscribed to DNA using the VILO Kit (Thermo Fisher) quantified by Gag-qPCR [59 (link)].
Vilo kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The VILO kit is a laboratory reagent used for cDNA synthesis. It facilitates the conversion of RNA into complementary DNA (cDNA) molecules, which can be used for various downstream applications in gene expression analysis and molecular biology research.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Dneasy rneasy blood and tissue kits, by Qiagen (2 mentions)
Perfecta sybr green supermix, by Quantabio (2 mentions)
Icycler, by Bio-Rad (2 mentions)
Cfx384, by Bio-Rad (2 mentions)
Allprep dna rna mini, by Qiagen (2 mentions)
Tri reagent, by Merck Group (1 mentions)
Powerup sybr green qpcr master mix, by Thermo Fisher Scientific (1 mentions)
Absolute blue qpcr sybr green rox mix, by Thermo Fisher Scientific (1 mentions)
Facsaria 3, by BD (1 mentions)
Exosap it, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Sybr green, by Qiagen (1 mentions)
Biomek fx laboratory automation workstation, by Beckman Coulter (1 mentions)
Dnase 1, by Qiagen (1 mentions)
Magna pure lc, by Roche (1 mentions)
Tapestation instrument, by Agilent Technologies (1 mentions)
Ampure xp, by Agilent Technologies (1 mentions)
Sybr green, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
25 protocols using vilo kit
1
Quantifying SIV Infection in Macaques
2
Transposon-based cDNA sequencing protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using the Qiagen Universal kit. 1 μg was used to perform First-strand cDNA synthesis using Vilo kit (ThermoFisher) according to manufacturer’s instructions. cDNA was diluted 1:4 in ultrapure water aliquoted and stored for further analysis. For transposon-based sequencing, second strand cDNA synthesis was performed using Klenow fragment DNA polymerase (NEB). cDNA was treated with Nextera Tn5 transposon at 1:8 recommended concentration. Enrichment of the target transcript was performed by PCR using transcript specific primers (Ex22-Nextera-F or Ex24-Nextera-R) and a constant reverse primer specific for tag inserted by the transposon (Nextera-R). Amplicons were purified by Ampure beads at 1.8x and a second 10-cycle PCR was used to add adapters and barcodes. Reads were aligned to predicted amplicons and mis-aligned reads were discarded. Reads were then aligned to expected products and unexpected products were identified and quantified. qPCR was conducted using QuantaBio PerfeCTa SYBR® Green SuperMix using the primers listed in Table S8 .
3
Transposon-based cDNA sequencing protocol
4
RNA Extraction and RT-qPCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from mitotically active cell cultures using Tri-Reagent (Sigma/Aldrich) according to the manufacturer’s protocol. RNA was converted to cDNA using a VILO kit (Thermo Fisher) and the product diluted in RNase-free water prior to RT-qPCR using Power-UP SYBR Green qPCR master mix (Thermo Fisher). PCR reactions were performed in triplicate, and experiments were repeated. Primers used were: Zc3h8 For: 5′- CCGCCGACCCTGAGGAAAGAATTG-3′, Rev.: 5’-GGAAGTAATGAGGGTTGAGCTGCGT-3′; Gata-3 For: 5’-AGGGACATCCTGCGCGAACTGT-3′, Rev.: 5’-CATCTTCCGGTTTCGGGTCTGG-3′; Act1 For: 5’-GACGGCCAGGTCATCACTATTG-3′, Rev.: 5’-AGGAAGGCTGGAAAAGAGCC-3′, Gapdh For: 5’-GACAACTTTGGCATTGTGG-3′, Rev.: 5’-ATGCAGGGATGATGTTCTG-3′.
5
Quantifying SIV Viral Loads in Plasma and Tissues
6
Quantitative RT-PCR Assay for mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription was performed on 500 ng of total RNA using the Vilo kit (Invitrogen). Quantification was performed on triplicates using the ABsolute Blue QPCR SYBR Green ROX Mix (Thermo Scientific). Primers (Supplementary Table 1 ) were designed using the Primer3 software (http://primer3.ut.ee ) on separate exons to produce 100-bp amplicons avoiding DNA amplification. The GAPDH gene was used for normalization based on its observed expression stability in fibroblast cells.
7
Single-cell TCR Sequencing of Antigen-Specific CD8+ T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CD8+ T cell lines were tetramer-stained as above and single HLA-A*02:01-M158-tetramer+ CD3+dump-CD8+tetramer+ cells were single-cell sorted on a FACS Aria III (BD Biosciences) into 80 wells of a 96-well twin-tec plate (Eppendorf, Hamburg, Germany). The CDR3αβ regions were determined by a novel single-cell multiplex reverese transcription PCR (RT-PCR) protocol.21 (link), 28 mRNA transcripts were reverse-transcribed to cDNA, using a VILO kit (Invitrogen). For the internal round of PCR, 2.5 μl of the external product was used as template, with either a set of TRAV or TRBV internal primers.28 The internal PCR reaction included the two different primers sets at 5 pmol ml−1 (TRAV and TRAC, or TRBV and TRBC). Positive PCR products were purified with Exo-SAP-IT (Affymetrix, Santa Clara, CA, USA) and sequenced using TRAC or TRBC internal primers with BigDye v3.1 (Applied Biosciences, Foster City, CA, USA). Sequences were cleaned using DyeEx sequencing plates (QIAGEN) and sequencing was performed at the Sequencing and Genotyping facility within the Department of Pathology at the University of Melbourne. Sequences were analysed using FinchTV, and V and J region usage was identified by IMGT query (www.imgt.org/IMGT_vquest ).
8
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the RNeasy Mini Kit (Qiagen, Valencia, CA) according to the manufacturer's protocol, tested for quality, and stored at −80°C until use. The VILO kit (Life Technologies/Invitrogen, Grand Island, NY) was used to reverse transcribe 150 ng of total RNA. Primers (Qiagen) were diluted 1∶20 with molecular-grade water, and 5 µL/well were added to 384-well plates using a Biomek FX Laboratory Automation Workstation (Beckman Coulter, Inc., Brea, CA). The plates were left to dry overnight in a sterile hood and stored covered at −20°C until use. qRT-PCR was performed using SYBR Green (Qiagen) and a 7900HT Real-Time PCR System (Life Technologies/Applied Biosystems, Foster City, CA) operated in standard mode. All of the runs contained a dissociation step. The samples were amplified in duplicate in a total volume of 5 µL. The results are expressed as the relative copy number (RCN), defined as RCN = 2−ΔCq×100, where ΔCq is the difference Cq(target) – Cq(reference) [27] (link). As a reference for normalization, we used the median Cq values of three endogenous controls (beta-2 microglobulin, GAPDH and RPL13). Data were were uploaded to Gene Expression Omnibus (GSE56327).
9
RNA Extraction and Real-Time qPCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissue samples were homogenized in TRIzol reagent (Invitrogen), and total RNA was extracted using RNeasy columns with DNase I treatment (Qiagen, Valenica, CA). cDNA was synthesized by VILO kit (Invitrogen), following the manufacturer’s instructions. The StepOnePlus 96-well machine (Applied Biosystems, Foster City, CA) was applied for real-time quantitative PCR analysis. PCR products were detected using SYBR Green and normalized to 18S ribosomal RNA, using specific oligonucleotides (primer sequences are available at request).
10
Quantifying Histone Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from 10 to 20 salivary glands with TRIZOL reagent (Invitrogen) according to the manufacturer’s recommendations. 1 µg of total RNA was used in random-primed reverse transcription reaction using VILO kit (Invitrogen). Expression was assessed using standard curve procedure, as described above. Actin 42A gene was used for normalizations. Each experiment was repeated twice with three technical replicates each.
| H1-F | AGGCAAAGTCGAAGGTTTTGT |
| H1-R | TTAGCTTTGGGCTTTTTGTCA |
| H2A-F | AGTGAAGGGAAAGGCAAAGTC |
| H2A-R | TTCCATTACGGCAGCTAGGTA |
| H2B-F | AGGATGGACCTGCTTGAGAAC |
| H2B-R | AACATCACCAAGACCGACAAG |
| H3-F | AGTGAAACCCAAATCGGAGAT |
| H3-R | CGGCCTTAGTAGCCAGTTGTT |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!