Pcr primers

Manufactured by Thermo Fisher Scientific

Sourced in United States, China

PCR primers are short DNA sequences that serve as the starting points for DNA replication in the polymerase chain reaction (PCR) process. They are designed to bind to specific target sequences within the DNA sample, enabling the amplification of those regions.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Real-time PCR primers (15 citations) QRT-PCR primers (14 citations) RT-PCR primers (13 citations) TaqMan PCR primers (12 citations) Specific PCR primers (8 citations) TaqMan real time PCR primers (4 citations) Superscript III First Strand Synthesis System for RT-PCR kit with oligo (dT) primers (4 citations) TaqMan PCR Master Mix with gene-specific primers (3 citations) TaqMan Gene Expression Assays specific PCR primers sets (3 citations) PCR) primers and reagents (2 citations)

57 protocols using pcr primers

Rat DRG Total RNA Extraction and Versican Splice Variant Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from 20 rat DRG was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) with the PureLink™ RNA mini kit (Life technologies, Grand Island, NY, USA) according to the manufacturers instructions. The amount of RNA was quantified with a spectrophotometer, and cDNA preparation was carried out with 1 μg of total RNA/sample and the superscript III platinum 1-step RT-PCR system (Life technologies). The PCR primers (Invitrogen) used for the amplification of the different versican splice variants according to the National Center for Biotechnology Information database entry NM_001170558 were: Vcan_exon4_for = 5′-GCG ACC AGC AGA TAC ACT CT-3′; Vcan_exon7_for = 5′-CCA TTC ACT GAG GAA CCA CAC AT- 3′; Vcan_exon8_rev = 5′-GGG TGT CAG TTG CGG AAG TAT TTG-3′; Vcan_exon11_rev = 5′-CAT GTA CGG CGA TGA GCA AAG TA-3′.

Bogen O., Bender O., Löwe J., Blenau W., Thevis B., Schröder W., Margolis R.U., Levine J.D, & Hucho F. (2015). Neuronally produced versican V2 renders C-fiber nociceptors IB4-positive. Journal of neurochemistry, 134(1), 147-155.

+ Open protocol

+ Expand

Characterizing Macrophage Phenotypes by PCR and Immunostaining

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR and fluorescent immunostaining was used to characterize macrophage phenotype, n=4 for 3 independent repeats. PCR: RNA extraction was performed as per manufacturer’s protocol (RNeasy, Qiagen, Gaithersburg, MD). RNA concentrations was determined using Nanodrop (Thermo Scientific, Waltham, MA), and reverse transcription to cDNA was performed using iScript (Qiagen), followed by RT-PCR using a Biorad 7300 (Biorad, Berkeley, CA) and SsoAdvanced SYBR-green KIT (Qiagen). PCR primers were purchased from Invitrogen. For M1 phenotype IL-1 (forward primer: GCTTGGTGATGTCTGGTCCAT, reverse primer: CACCACTTGTTGCTCCATATCCT) [20 (link)] and M2 phenotype CD-36 (forward primer: TCACTGCGACATGATTAATGGTACA, reverse primer: ACGTCGGATTCAAATACAGCATAGAT) was used [21 (link)]. Amplification of the genes of interest was normalized to the amplification of L37-a (forward primer: ATTGAAATCAGCCAGCACGC, reverse primer: AGGAACCACAGTGCCAGATCC), a housekeeping gene constitutively expressed by macrophage phenotypes [21 (link)]. CT values were generated by the software were compared to L37-a expression. Expression of gene of interest was normalized to control expression noted in each experiment. Fluorescent immunostaining of cell surface markers of macrophage phenotype was performed for CD68 (pan-macrophage), IL-1r (M1), CD36 (M2) and CD206 (M2), (BioLegend, San Diego, CA).

Kumar V.A., Taylor N.L., Shi S., Wickremasinghe N.C., D’Souza R.N, & Hartgerink J.D. (2015). Self-Assembling Multidomain Peptides Tailor Biological Responses through Biphasic Release. Biomaterials, 52, 71-78.

+ Open protocol

+ Expand

Identifying CRYBB2 gene mutation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The whole exome sequencing and data analysis has revealed a heterozygous mutation in CRYBB2 gene. Then direct sequencing was utilized to identify the variation in the family members and the normal subjects. PCR primers aiming to amplify fragments flanking the candidate loci were synthesized by Invitrogen, Shanghai, China (CRYBB2-exon6-F: ctc gcctctctctctgtctg; CRYBB2-exon6-R: gacccacagcagacaagttg). The direct sequencing was conducted on the ABI 3730 Genetic Analyzer (Applied Biosystems) following the standard procedures and the data were analyzed via the Human Genomic Database.

Zhou Y., Zhai Y., Huang L., Gong B., Li J., Hao F., Wu Z., Shi Y, & Yang Y. (2016). A Novel CRYBB2 Stopgain Mutation Causing Congenital Autosomal Dominant Cataract in a Chinese Family. Journal of Ophthalmology, 2016, 4353957.

+ Open protocol

+ Expand

Radioactive RNA Synthesis and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR primers were from Invitrogen. All other PCR reagents were from New England Biolabs and Genscript. The radioactive [α³²P] CTP was from Perkin Elmer. T7 transcription and RNA purification kits were from Promega. RNeasy and other RNA purification kits were from Qiagen. NiNTA beads were from Gold Bio. All other chemicals were purchased from Sigma.

Jeeva S., Pador S., Voss B., Ganaie S.S, & Mir M.A. (2017). Crimean-Congo hemorrhagic fever virus nucleocapsid protein has dual RNA binding modes. PLoS ONE, 12(9), e0184935.

+ Open protocol

+ Expand

Buccal Swab Genotyping of CD36 SNP

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were collected from each participant by gently rolling a swab (Epicentre, Madison, WI, U.S.A.) on the buccal surfaces of the mouth between the cheek and gums. DNA was extracted and purified using the Maxwell 16 Buccal Swab LEV DNA Purification Kit and the Promega Maxwell (Promega, Madison, WI, U.S.A.). The target area of CD36 (NCBI Gene Identity 948) was amplified using PCR primers (Forward: tccattgaagcccttctgtt, Reverse: attctaaggcgggaagcttc, Invitrogen, Carlsbad, CA, U.S.A.) and sequenced using the forward primer (High Throughput Genomics Center, Seattle, Wash., U.S.A.). Sequences were analyzed using the program Geneious (Geneious, Newark, NJ, U.S.A.) to determine the nucleic acid at position 13436 (SNP rs1761667, NCBI Reference Sequence NG_008192.1).

Burgess B., Melis M., Scoular K., Driver M., Schaich K.M., Keller K.L., Tomassini Barbarossa I, & Tepper B.J. (2018). Effects of CD36 Genotype on Oral Perception of Oleic Acid Supplemented Safflower Oil Emulsions in Two Ethnic Groups: A Preliminary Study. Journal of Food Science, 83(5), 1373-1380.

+ Open protocol

+ Expand

Quantitative Analysis of mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted and purified from cells and tissue samples using TRIzol Reagent (Invitrogen, USA), according to the manufacturer’s instructions. The cDNA was then synthesized using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Dalian, China). We performed qRT-PCR using the QuantiFast SYBR Green PCR Kit (Qiagen, Germany) on an ABI StepOnePlus Fast real-time PCR system (Applied Biosystems) to assess mRNA expression. The specificities of amplification products were confirmed by melting curve analysis and agarose gel electrophoresis, and GAPDH was used to normalize the mRNA levels. PCR primers were purchased from Invitrogen (Shanghai, China), and the sequences were as follows: TTP: CGCTACAAGACTGAGCTAT, GAGGTAGAACTTGTGACAGA; IL-33: GACTCCTCCGAACACAGAGC, CCCAGCTTGAAACACAAGGC; GAPDH: ACGGATTTGGTCGTATTGGGC, TTGACGGTGCCATGGAATTTG. The relative expression levels of the target genes were quantified by the 2^−ΔΔCT method, and all samples were measured in triplicate.

Deng K., Wang H., Shan T., Chen Y., Zhou H., Zhao Q, & Xia J. (2016). Tristetraprolin inhibits gastric cancer progression through suppression of IL-33. Scientific Reports, 6, 24505.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative reverse transcriptase‐polymerase chain reaction (qRT‐PCR) was performed in the QuantStudio 3 Real‐Time PCR System (Applied Biosystems, Carlsbad, California) using the PowerUp SYBR Green Master Mix (Applied Biosystems). C_t for each gene was determined and ΔΔC_t was calculated relative to the designated reference sample. Gene expression values were then set equal to 2^−ΔΔCt as described by the manufacturer of the kit (Applied Biosystems). PCR primers were synthesized by Invitrogen and the sequences are shown in Table S1. Hypoxanthine Phosphoribosyltransferase, ribosomal Protein Lateral Stalk Subunit P0, and peptidyl‐Prolyl‐Cis‐Trans Isomerase A were used as housekeeping genes.

Duhachek‐Muggy S., Bhat K., Medina P., Cheng F., He L., Alli C., Saki M., Muthukrishnan S.D., Ruffenach G., Eghbali M., Vlashi E, & Pajonk F. (2019). Radiation mitigation of the intestinal acute radiation injury in mice by 1‐[(4‐nitrophenyl)sulfonyl]‐4‐phenylpiperazine. Stem Cells Translational Medicine, 9(1), 106-119.

+ Open protocol

+ Expand

Quantifying Cardiac ER Stress Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from left ventricular tissue homogenates of heart by using the TRIzol reagent (Invitrogen, USA) according to the manufacture's specifications. 1 μg of total RNA was reversely transcribed to complementary DNA (cDNA) using Transcriptor First Strand cDNA Synthesis Kit (Roche, Germany). Real-time QPCR was performed by using Power SYBR Green QPCR Master Mix (Applied Biosystems, Foster City, California, USA) and PCR primers (Invitrogen, USA) for rat ER stress-related genes: GRP78 (forward (5′- GCAGTTGCTCACGTGTCTTG-3′); reverse (5′- TCCAAGGTGAACACACACCC-3′)), CHOP (forward (5′- CGCATGAAGGAGAAGGAGCA-3′); reverse (5′- TGTGGTCTCTACCTCCCTGG-3′))and β-actin (forward (5′- CAGGGTGTGATGGTGGGTATGG-3′); reverse (5′- AGTTGGTGACAATGCCGTGTTC-3′)). Cycling parameters were as follows: 95°C, 10 minutes and 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. The dissociation curves were performed to verify that a single product was obtained. All PCR assays were performed in triplicate. The PCR fluorescent signals for GRP78 and CHOP were standardized to PCR fluorescent signals obtained from an endogenous reference (β-actin). Comparative and relative quantifications of these gene products normalized to β-actin and the control group were calculated by the 2^−△△Ct method.

Ding W., Zhang X., Huang H., Ding N., Zhang S., Hutchinson S.Z, & Zhang X. (2014). Adiponectin Protects Rat Myocardium against Chronic Intermittent Hypoxia-Induced Injury via Inhibition of Endoplasmic Reticulum Stress. PLoS ONE, 9(4), e94545.

+ Open protocol

+ Expand

Quantitative Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from gastric tissues or cell lines were extracted using Trizol reagent (TaKaRa) according to the manufacturer’s instructions. cDNA was synthesized with the PrimeScript RT reagent kit (TaKaRa). Quantitative RT-PCR was carried out with a SYBR Premix Ex Taq kit (TaKaRa) on a 7500 real time PCR system (ABI) and analyzed with the SDS analysis software package (version 2.0.1, Applied Biosystems). PCR primers were obtained from Invitrogen, and the reaction was 95°C, 10 min,followed by 40 cycles of 95°C 15 seconds and 60°C, 1 min. The U6 snRNA was used as an internal control. The results were presented as fold change, calculated using the 2^-△CT method, and a ratio of expression in the tumors relative to the normal tissues less than 1.0 was considered as low.

Ren J., Huang H.J., Gong Y., Yue S., Tang L.M, & Cheng S.Y. (2014). MicroRNA-206 suppresses gastric cancer cell growth and metastasis. Cell & Bioscience, 4, 26.

+ Open protocol

+ Expand

FGFR2 Polymorphisms Genotyping

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Whole blood genomic DNA of subject was extracted by Blood Genome DNA Extraction Kit (TaKaRa, Dalian) according to the manufacturer’s instruction, −20°C storage for standby application. Polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP) was used to conduct the genotyping of FGFR2 polymorphisms. PCR primers were synthesized in Invitrogen, Shanghai according to the sequences reported by Siddiqui and Liu [17 (link),18 (link)]. The detailed sequences are shown in Table 1. The 25 μl PCR system was used in the present study and PCR procedure was as follows: 95°C pre-degeneration for 5 min, followed by 35 cycles of 95°C degeneration for 30 s, annealing at 55–60°C for 30 s, 72°C extension for 30 s, and final extension at 72°C for 10 min. PCR products were detected by 1.0% agarose gel electrophoresis (AGE). Then eligible PCR products were digested by restriction enzymes (Table 1) and enzyme-digested products were separated by 3% AGE, then observed on the Gel Doc 2000 system (Bio-Rad, U.S.A.).

Yang Y., Fei M., Zhou X., Li Y, & Jin D. (2019). The association of genetic variants in FGFR2 with osteoporosis susceptibility in Chinese Han population. Bioscience Reports, 39(6), BSR20190275.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!