Retn snp probes

Four RETN SNP probes were purchased from Thermo Fisher Scientific Inc. (USA), and assessment of allelic discrimination for RETN SNPs was conducted using a Roche LightCycler 480 Instrument II (Roche, Mannheim, Germany). Data were further analyzed with LightCycler 480 Software, Version 1.5 (Roche). PCR was carried out in a total volume of 10 μL, containing 20 to 70 ng genomic DNA, 1 U Taqman Genotyping Master Mix (Thermo Fisher, Applied Biosystems, Foster City, CA), and 0.25 μL probes. The sequence of 4 RETN SNP probes was described as follows: rs3745367, CTCCGACTGTCCCCACCTTATCCAC[A/G]GCTCCAAACCCAA; rs7408174, TTTTACCACAAAAAGGCCCGTTGTA[C/T]TGGAAACAAAGAA; rs1862513, CCTGACCAGTCTCTGGACATGAAGA[C/G]GGAGGCCCTGTTG; rs3219175, CTCCAGCCCTTACTGTCTGCTCAGG[A/G]GCTTCCTCTTGGC. The protocol included an initial denaturation step at 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute.

Four RETN SNP probes were purchased from Thermo Fisher Scientific Inc., and assessment of allelic discrimination for RETN SNPs was conducted using a Roche LightCycler 480 Instrument II (Roche, Germany). Data were further analyzed with LightCycler 480 Software, Version 1.5 (Roche). PCR was carried out in a total volume of 10 μL, containing 20 to 70 ng genomic DNA, 1 U Taqman Genotyping Master Mix (Applied Biosystems, Foster City, CA), and 0.25 μL probes. The protocol included an initial denaturation step at 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute.