Plko 1

Lentiviral particles for scrambled control and two different Nox5 small hairpin RNA (shRNA) sequences were generated in HEK293FT cells (Invitrogen, Carlsbad, CA, USA) using the packaging plasmids pMD2.G and psPAX2 (Addgene; Cambridge, MA, USA) and the lentiviral vector pLKO.1 containing Nox5-specific shRNA (clone ID TRCN0000046099 or TRCN0000046101 from Dharmacon, GE Lifesciences, USA) or scrambled control (Addgene plasmid 1864). Lentiviral titer was determined via application of serially diluted lentivirus-containing supernatant to U2-OS cells. After 24 h, puromycin selection was initiated (0.5 μg/ml), and 6 days later, colonies counted following staining with 1% crystal violet (Sigma-Aldrich, St. Louis, MO, USA). For lentiviral infection, 100 000 SH-SY5Y cells were seeded in 25 cm² flasks. The next day, culture medium containing 8 μg/ml hexadimethrine bromide (Sigma-Aldrich) and lentiviral particles at a multiplicity of infection of 40 was added to the cells. The infection was repeated again 48 h later. Puromycin selection (0.5 μg/ml) was started 48 h after the second infection, and the concentration doubled at 48 h intervals until the final selection concentration (2 μg/ml) was reached. Three independent experiments were performed generating three independent polyclonal sublines for each shRNA.

The mammalian expression vector for FLAG-epitope tagged WT PPARγ was described previously^{19 (link)}. WT human TRIM25 and its deletion mutants were kindly provided by Dr. V. Narry Kim^{30 (link)}. siRNAs for TRIM25 #1 (5′-CCTCGACAAGGAAGATAAA-3′) and #2 (5′-GCATCTGCTACGGAAGCAT-3′) were purchased from Shanghai GenePharma (Shanghai, China). HCT116 cells were transfected with the siRNAs using Lipofectamine RNAi MAC (Thermo Fisher Scientific, Waltham, MA). The sequences used for lentiviral short hairpin RNA (shRNA) expression vectors (pLKO.1; Dharmacon, Lafayette, CO) targeting TRIM25 were #1 (5′-TTCCTCAGTTTGTACTCCAGG-3′) and #2 (5′-ATGATCCAGATCTATCTTAGG-3′). For lentiviral production, HEK-293T cells were transfected with 10 µg of the lentiviral vectors. Following infection of the cells with the viral vectors, 3T3-L1 cells were selected by incubation with 2 μg/ml puromycin (MilliporeSigma, St. Louis, MO).

Lentiviral-mediated short-hairpin RNA (shRNA) was used for stable knockdown of TGF-β1 in human BM-derived MSCs. shRNA lentiviral vectors (NM_000660, XM_011527242; Clone ID: TRCN0000003318; Sequencing Primer: 5'—AAACCCAGGGCTGCCTTGGAAAAG—3'; Vector Map: pLKO.1) were purchased from GE Healthcare Dharmacon, Inc. (Lafayette, CO). Lentiviral pLKO.1 Empty Vector (Cat# RHS4080, GE-Dharmacon) was used as control. HEK293T cells were transfected with each TGF-β1 shRNA construct along with packaging vectors pMD2.G (0.5 μg) and psPAX2 (1.5 μg) (Addgene, Inc., Watertown, MA) using Jet Prime Reagent (Polyplus-transfection^®, Illkirch-Graffenstaden, France) according to the manufacturer’s guidelines. The medium containing lentivirus was collected 72 hours after transfection and incubated with BM-MSC cells for 24 hours. The transduced cells were selected using puromycin (0.5 μg/mL) for 3 days, and TGF-β1 mRNA and protein knockdown efficacy was determined by quantitative polymerase chain reaction (qPCR) or Western blotting, respectively. The plasmid TRCN0000003318 (RHS4533-EG7040, GE-Dharmacon) provided the best knockdown efficacy.

Short hairpin RNA (shRNA) plasmids for FOXM1 and NPM1 (pLKO.1), and short interfering RNA (siRNA) for ALK were all purchased from Dharmacon (Lafayette, CO, USA). The GFP shRNA plasmid was purchased from Addgene (Watertown, MA, USA) (#30323). Vectors for doxycycline inducible overexpression of FOXM1B/C vectors were made with the pCW57.1 vector (Addgene 68811 and 68810) [47 (link)]. The empty vector luciferase reporter and FOXM1 luciferase reporter containing FOXM1 consensus sequences were based on the pGL4.10 backbone [48 (link)]. The NPM-ALK (pcDNA3.1) plasmid was a gift from Dr. Stephan Morris. NPM-ALK^WT and NPM-ALK^FFF (HB tagged) expression vectors have been previously characterized [23 (link)].

The lentivirus construct pLKO.1 carrying shRNA specific for Cited2 was purchased from Dharmacon. The recombinant lentivirus containing Cited2 shRNA was packaged using Vira Power (Fisher Thermo Scientific) in 293FT cells using the manufacturer's protocol. For shRNA-mediated depletion of Cited2, WT, and Vezf1^−/− ESCs were transfected by lentivirus at a multiplicity of infection of 2 followed by selection of transgenic lines with stably integrated lentivirus construct using 3 μg/ml of puromycin.