Drug treatment via intravenous (IV) injection was initiated 1 day before RSV infection, at the following dosages: recombinant human ACE2 protein (R&D Systems, Minneapolis, MN, USA; Sino Biological Inc., North Wales, PA, USA), 0.1 mg/kg; losartan, an AT1R inhibitor (Merck, Kenilworth, NJ, USA), 15 mg/kg; PD123.319, an AT2R inhibitor (Tocris Bioscience, Bristol, UK), 15 mg/kg; or 1X PBS (vehicle control).
Recombinant human ace2 protein
Manufactured by R&D Systems
Sourced in United States
Recombinant human ACE2 protein is a soluble form of the human angiotensin-converting enzyme 2 (ACE2) protein, produced using recombinant DNA technology. ACE2 is a key enzyme involved in the regulation of the renin-angiotensin system, which plays a role in the control of blood pressure and fluid balance. The recombinant human ACE2 protein can be used in research applications to study the function and interactions of the ACE2 protein.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Pd123319, by Bio-Techne (1 mentions)
Losartan, by Merck Group (1 mentions)
Vectastain elite abc avidin biotin complex kit, by Vector Laboratories (1 mentions)
Carbon nanotubes, by Merck Group (1 mentions)
Elix water purification system, by Merck Group (1 mentions)
Pamam dendrimer, by Merck Group (1 mentions)
Anti ace2 antibody clone 460502, by R&D Systems (1 mentions)
Sodium hydroxide (naoh), by Merck Group (1 mentions)
Ethanolamine, by Merck Group (1 mentions)
Dnase 1, by New England Biolabs (1 mentions)
Dynabeads his tag, by Thermo Fisher Scientific (1 mentions)
5 protocols using recombinant human ace2 protein
1
RSV Infection Treatment Protocols
2
Immunohistochemical Detection of ACE-2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Formalin-fixed, paraffin-embedded tissue sections (7 μm) were cut and de-waxed prior to immunohistochemistry. Sections were pre-treated in trisodium citrate buffer (9 mM), pH 6, and microwaved for 5 minutes, left to stand for 5 minutes, and boiled for a further 5 minutes before being left to stand for 15 minutes at room temperature. Sections were then rinsed thoroughly and covered in horse serum blocking solution, rinsed again, and incubated overnight at room temperature with anti-ACE-2 antibody (0.05 μg/ml, ab15348; Abcam). Bound antibody was visualised using a biotinylated universal antibody followed by VECTASTAIN Elite ABC avidin-biotin complex kit (Vector Laboratories, Peterborough, UK) and a reaction with 0.01% H2O2. Specificity of the antibody was assessed by pre-adsorption of the ACE-2 antibody with a 250-fold molar excess of recombinant human ACE-2 protein (R&D Systems).
3
Functionalization of Nanoparticles for ACE2 Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All PAMAM dendrimers, carbon nanotubes, and inorganic nanoparticle powders were purchased from Sigma-Aldrich PAMAM nanoparticles were air-dried on a super-clean bench for 24 hrs to remove the methanol before an equal volume of PBS was added to the tube. The samples were mixed and stored at 4°C before use. The anti-ACE antibody (2E2) was purchased from Santa Cruz Biotechnology, Inc. The anti-ACE2 antibody (clone 460502) and recombinant human ACE2 protein were purchased from R&D systems. The anti-β-actin antibody (clone AC-15), angiotensin II (human), losartan and Evans blue were purchased from Sigma-Aldrich. HS-PEG-COOH (Mw = 2000 Da), HS-PEG-NH2 (Mw = 2000 Da), and HS-(CH2)11-EG6-OH (Mw = 468 Da) were purchased from Shanghai Yare Biotechnology, Inc. 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC), N-hydroxysuccinimide (NHS), ethanol, NaOH, and ethanolamine were purchased from Sigma-Aldrich. All these reagents were used without further purification. Milli-Q water was obtained from a Millipore − ELIX water purification system. All buffers and reagents used were degassed and filtered prior to use in the SPR experiments.
4
Quantifying SARS-CoV-2 Spike Protein Interactions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The biotinylated recombinant SARS-CoV-2 spike protein RBD with His-tag, recombinant SARS-CoV-2 spike B.1.617.2 with His-tag and recombinant human ACE-2 protein were purchased from R&D Systems, Inc. High precision streptavidin (SAX) and anti-penta-His (high precision streptavidin (SAX)) biosensors obtained from the Sartorius Corporation. A solution of the spike protein at a 1 μg ml−1 concentration was loaded onto the corresponding hydrated biosensors. Each labeled biosensor was placed in different molar concentrations (120, 48, 24, 4.8, and 0.48 μM) of pep39, and association was measured for 120 seconds and followed by dissociation with PBS for 120 seconds. PBS buffer alone and 44 μg ml−1 human ACE-2 protein were used as a reference and a positive control, respectively. Experimental association and dissociation constants from all experiments were globally fitted using a 1 : 1 binding model to measure the dissociation constant Kd using the built-in software BLItzPro version 1.1. All binding assays were performed on the FortéBio BLItz instrument.
5
Quantifying SARS-CoV-2 Pseudovirus-ACE2 Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To ensure that equal amounts of pseudovirions were used in the study, input pseudovirions were quantified by a reverse transcription-quantitative PCR (RT-qPCR) assay. To eliminate the contamination of packaging plasmids in the assay, pseudovirion stocks were pretreated with DNase I (catalog number M0303L; New England BioLabs) at 37°C for 20 min, followed by viral RNA isolation (QIAamp viral RNA minikit, catalog number 52906). RT-qPCR quantification was conducted using the following primers and probe: forward primer GGCTGAATACAAACCATCGG , reverse primer CGCTCGTTGTAGATGTCGTTAG , and probe FAM (6-carboxyfluorescein)-CCCTGTTCATCGGTGTGGCTGT -BHQ1 (black hole quencher 1).
A total of 1010 RNA copies of pseudovirions were incubated with 1.5 μg recombinant human ACE2 protein (catalog number 933-ZN-010; R&D Systems) or mouse ACE2 protein (catalog number 3437-ZN-010; R&D Systems) and 15 μl His tag Dynabeads (catalog number 10103D; Thermo Fisher) for 3 h at room temperature. After incubation, the resulting beads were washed three times with phosphate-buffered saline (PBS), followed by RNA isolation with TRIzol reagent (catalog number 15596026; Thermo Fisher). Bound pseudoviral RNA was quantified using RT-qPCR. The binding of each pseudovirion was normalized against the level of binding (“noise”) obtained when an equal amount of bald pseudovirions was used in the assay.
A total of 1010 RNA copies of pseudovirions were incubated with 1.5 μg recombinant human ACE2 protein (catalog number 933-ZN-010; R&D Systems) or mouse ACE2 protein (catalog number 3437-ZN-010; R&D Systems) and 15 μl His tag Dynabeads (catalog number 10103D; Thermo Fisher) for 3 h at room temperature. After incubation, the resulting beads were washed three times with phosphate-buffered saline (PBS), followed by RNA isolation with TRIzol reagent (catalog number 15596026; Thermo Fisher). Bound pseudoviral RNA was quantified using RT-qPCR. The binding of each pseudovirion was normalized against the level of binding (“noise”) obtained when an equal amount of bald pseudovirions was used in the assay.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!