The largest database of trusted experimental protocols

Mx3000p multiplex quantitative pcr system

Manufactured by Agilent Technologies
Sourced in United States

The Mx3000P Multiplex Quantitative PCR system is a real-time PCR instrument designed for high-performance nucleic acid quantification. It has the capability to detect and quantify multiple gene targets simultaneously in a single reaction.

Automatically generated - may contain errors

6 protocols using mx3000p multiplex quantitative pcr system

1

Quantitative Real-Time PCR of Sgk1, Pvalb, and Ncx1

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primers used in real time PCR for human and mouse Sgk1, Sgk1_v3 and 18S rRNA have been published (Raikwar et al. 2008, 2012). Other primer sequences were parvalbumin: mPvalb_F: AGTTGCAGGATGTCGATGACAGA; mPvalb_R: GGCCCACCATCTGGAAGAACTTTT and NaCa exchanger1: mNcx1_F: GCCGAGCATTTTACAGGATTCAAGC; mNcx1_R: GCCACAGTACCACAGTTCTCTAGAC. Quantitative real time PCR was performed in a Mx3000p Multiplex quantitative PCR system (Agilent Technologies) and dissociation curves were generated for all samples. The number of cycles, annealing temperature, and extension time were varied as appropriate for the abundance of transcripts, the melting temperature of primers, and the size of amplicons. All reactions were performed using 18S as a control for RNA loading and the results quantified using the delta delta Ct method (Raikwar et al. 2012).
+ Open protocol
+ Expand
2

Quantitative RT-PCR Analysis of HS3ST3B and Nrp1

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from 2 × 105 cells using the NucleoSpin RNA II kit (Macherey-Nagel, Düren, Germany). Reverse transcription was performed from 1 μg of total RNA by using the Maxima First Strand cDNA Synthesis Kit for RT-qPCR (Thermo Fisher Scientific). Synthetic primers for HS3ST3B and Nrp1 were described in [43 (link),48 (link)], respectively. They were checked for their specificity by semi-quantitative RT-PCR on a 2.5% (w/v) agarose gel. They amplified only one fragment of expected size, for which the sequence was confirmed (GATC Biotech, Constance, Germany). Real-time PCR amplifications were performed using an Mx3000P Multiplex Quantitative PCR system (Agilent Technologies, Santa Clara, CA, USA), as described in [49 (link)]. The transcript of HPRT was used as a control to normalize the expression of our genes of interest. The amplification efficiency of each primer pair was performed on serial dilutions of cDNA. The average Ct of triplicate samples was used for analysis.
+ Open protocol
+ Expand
3

Profiling GLI2 Cytokine Targets

Check if the same lab product or an alternative is used in the 5 most similar protocols
HS-5 stromal cells (4 × 106) were transfected with GLI2 overexpression construct. After 48 hours, cells were collected, RNA was isolated and reverse transcribed. Samples were then screened for GLI2 cytokine targets by qPCR using RT2 Profiler PCR Arrays kit from Qiagen (Hilden, Germany). Samples were analyzed on a Mx3000p Multiplex Quantitative PCR system (Agilent Technologies, Santa Clara, CA).
+ Open protocol
+ Expand
4

Quantitative Analysis of Sulfated Glycosaminoglycans

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from 2×105 cells using the NucleoSpin RNA II kit, according to the instructions of the manufacturer (Macherey-Nagel, Düren, Germany). Reverse transcription was performed from 1 μg of total RNA by using the Maxima First Strand cDNA Synthesis Kit for RT-qPCR (Thermo Fisher Scientific). Synthetic primers for HS3ST3A, HS3ST3B and HS3ST4 were described in [24 (link)]. Synthetic primers for HS3ST2 were designed by using Primer-Blast (NCBI): 5’-GCTCTCGAGGGTCCTGGGCA-3’ (forward), 5’-TGTGGGCGTGAAGAAGGGGG-3’ (reverse). Specificity of the primers was checked by semi-quantitative RT-PCR on a 2.5% (w/v) agarose gel. All of them amplified only one fragment of expected size, for which the sequence was confirmed (GATC Biotech, Constance, Germany). Real-time PCR amplifications were performed using an Mx3000P Multiplex Quantitative PCR system (Agilent Technologies, Santa Clara, CA, USA), as described in [26 (link)]. The transcript of HPRT was used as a control to normalize the expression of our genes of interest. The amplification efficiency of each primer pair was performed on serial dilutions of cDNA. The point at which the PCR product was first detected above a fixed threshold, termed cycle threshold (Ct), was determined for each sample, and the average Ct of triplicate samples was used for analysis.
+ Open protocol
+ Expand
5

Quantitative PCR Analysis of Transgene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
qPCR experiments were performed on the Mx3000P Multiplex Quantitative PCR System (Agilent Technology, La Jolla, CA, USA) using as template 1 μL of the cDNA, synthesized from total RNA according to the Invitrogen SuperScript II RNase-reverse transcriptase manual (Life Technologies Corporation, Carlsbad, CA, USA) and Brilliant SYBR® Green QPCR Master Mix (Agilent Technologies, La Jolla, CA, USA). Cycling conditions were: 10 min at 95 °C for activation of the Hot start Taq polymerase and 40 cycles for the melting (30 s at 95 °C), annealing (30 s at 61 °C), and extension (30 s at 72 °C). Each qPCR measurement was carried out in triplicate using specific primers for either ShBLE or APHVIII (Table A1). The UBC8 gene, encoding a ubiquitin ligase polypeptide (XM_001697453), whose expression was previously shown to be constitutive under the different conditions used [52 (link),53 (link)] and was used as a housekeeping gene to normalize mRNA abundance. 2−ΔΔCT approach was used to calculate fold change relative to the expression level of a reference clone, which was chosen among the transformants which showed the lowest values [54 (link)].
+ Open protocol
+ Expand
6

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from EAT tissues or H9C2 rat cardiomyoblasts using TRIZOL reagent (Invitrogen), and each 500‐ng aliquot of RNA was reverse transcripted to complementary DNA using PrimeScript RT Master Mix (Takara). SYBR Green quantitative polymerase chain reaction assays were performed using the MX3000P Multiplex Quantitative PCR System (Agilent Technologies), the Brilliant SYBR Green QPCR Master Mix Kits (Agilent Technologies), and the specific primers. Primers used for polymerase chain reaction were as follows: leptin (forward, 5′‐CCAAAACCCTCATCAAGACC‐3′; reverse, 5′‐GTCCAACTGTTGAAGAATGTCCC‐3′), adiponectin (forward, 5′‐GGAAACTTGTGCAGGTTGGATG‐3′; reverse, 5′‐GGGTCACCCTTAGGACCAAGAA‐3′), IL‐6 (forward, 5′‐TCCTACCCCAACTTCCAATGCTC‐3′; reverse, 5′‐TTGGATGGTCTTGGTCCTTAGCC‐3′), TNF‐α (forward, 5′‐AGCATGATCCGAGATGTGGAA‐3′; reverse, 5′‐TAGACAGAAGAGCGTGGTGGC‐3′), and GAPDH (forward, 5′‐AACGACCCCTTCATTGAC‐3′; reverse, 5′‐TCCACGACATACTCAGCAC‐30). The relative quantities of complementary DNA were calculated from cycle thresholds and were normalized to GAPDH gene using the 2−∆∆Ct method.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!